We narrowed to 32 results for: ung
-
TypeCollection... Plasmid Collections Synthetic Biology Fungal Synthetic Biology: Fungal SynBio Resources...collection of synthetic biology plasmids for use in fungus. Fungal Plasmids Search the table by keyword or sort... for use in fungus. Plasmid...
-
Validated gRNA Sequences
TypeCollection...pyogenes 23360964 Joung fh D. rerio GGAGCGGTACATGGCGACCG 42243 cut S. pyogenes 23360964 Joung GABPA H. sapiens...pyogenes 23360964 Joung RNF2 H. sapiens GTCATCTTAGTCATTACCTG 47509 cut S. pyogenes 23792628 Joung rol-6(su1006...pyogenes 23360964 Joung tph1a D. rerio GGGAAAACACAACCGCAGCC 42249 cut S. pyogenes 23360964 Joung TRE3G H. sapiens...pyogenes 23792628 Joung VEGF H. sapiens GGGTGGGGGGAGTTTGCTCC 47505 cut S. pyogenes 23792628 Joung VEGF H. sapiens...GGATGAGCCAAGAAGCCGCT 42241 cut S. pyogenes 23360964 Joung ASCL1 H. sapiens TGGATGGAGAGTTTGCAAGGAGC 64131 activate...crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1...GGAAACTACAGCCCAGCGTC 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection..., cut S. pyogenes Joung MSP712 65768 Bacteria BsaI yes, interfere S. pyogenes Joung sgRNA with U6 promoter...Mammalian U6 none As Cpf1 Joung BPK3082 78742 Mammalian U6 none Lb Cpf1 Joung pLentiCRISPR-E 78852 Mammalian... meningitidis Joung VVT1 65779 Mammalian BsmBI none, need plasmid 65776 S. aureus Joung BPK2101 65770 ...Goldstein DR274 42250 C. elegans BsaI none S. pyogenes Joung pCFD3-dU6:3gRNA 49410 Drosophila BbsI none S. pyogenes... MLM3636 43860 Mammalian BsmBI none S. pyogenes Joung pSPgRNA 47108 Mammalian BbsI none S. pyogenes Gersbach...pSQT1313 53370 Mammalian BsmBI none S. pyogenes Joung PX461 (3rd Gen) 48140 Mammalian BbsI yes, nick S...Wente DR274 42250 Zebrafish BsaI none S. pyogenes Joung pCRISPathBrick 65006 Bacteria BsaI yes, interfere... -
CRISPR Guide
TypeCollection...Lee, J. K., Jeong, E., Lee, J., Jung, M., Shin, E., Kim, Y., Lee, K., Jung, I., Kim, D., Kim, S., & Kim,...Ramadoss, G. N., Shi, Q., Hung, K. L., Samelson, A. J., Pogson, A. N., Kim, J. Y., Chung, A., Leonetti, M. D...., Liu, M., Hibshman, G. N., Dangerfield, T. L., Jung, K., McCool, R. S., Johnson, K. A., & Taylor, D....Sousa, A. A., Harrington, L. B., Sternberg, S. H., Joung, J. K., Yildiz, A., & Doudna, J. A. (2017). Enhanced..., J. A., Khayter, C., Maeder, M. L., Reyon, D., Joung, J. K., & Sander, J. D. (2013). High-frequency off-target... Y., Sander, J. D., Reyon, D., Cascio, V. M., & Joung, J. K. (2014). Improving CRISPR-Cas nuclease specificity...., Peterson, R. T., Yeh, J. J., Aryee, M. J., & Joung, J. K. (2015). Engineered CRISPR-Cas9 nucleases ... -
Neurodegeneration Plasmid Collection
TypeCollection...Axel Brunger 12339 pBD-0071 VCP His T7 ALS Axel Brunger 12344 pBD-0010 VCP His T7 ALS Axel Brunger 12345...Axel Brunger 12346 pBD-0013 VCP His T7 ALS Axel Brunger 12347 pBD-0006 VCP His T7 ALS Axel Brunger 12348...Axel Brunger 12349 pBD-0070 VCP His T7 ALS Axel Brunger 12350 pBD-0069 VCP His T7 ALS Axel Brunger 12351...Axel Brunger 12352 pBD-0007 VCP His T7 ALS Axel Brunger 12353 pBD-0018 VCP His T7 ALS Axel Brunger 12354...Axel Brunger 12355 pBD-0022 VCP His T7 ALS Axel Brunger 12356 pBD-0024 VCP His T7 ALS Axel Brunger 12357...Axel Brunger 12358 pBD-0035 VCP His T7 ALS Axel Brunger 12359 pBD-0039 VCP His T7 ALS Axel Brunger 12360...Axel Brunger 12361 pBD-0072 VCP His T7 ALS Axel Brunger 12362 pBD-0050 VCP His T7 ALS Axel Brunger 12363... -
Zinc Finger Consortium: OPEN Reagents
TypeCollection...Reagents (Kit # 1000000013 ) Depositing Labs: Keith Joung This kit consists of plasmids and strains used to...and nonprofits only. You may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe... ML, Thibodeau-Beganny S, Sander JD, Voytas DF, Joung JK. Nature Protocols . 2009;4(10):1471-501. doi:...requires OPEN pools (available by request from the Joung lab) and the following reagents (listed below and...1997 ) and later modified by Pabo and colleagues ( Joung et al., PNAS 2000 ). The Oligomerized Pool ENgineering...protocol for practicing OPEN is available in the 2009 Joung Nature Protocols paper . How to Cite this Kit These... used in this publication was a gift from Keith Joung (Addgene kit # 1000000013)" For your Reference section... -
TALEN Engineering
TypeCollection...TALengineering Reagents Joung Lab TAL Effector Engineering Reagents You may also like... Keith Joung Lab plasmids...Reagents from the Keith Joung laboratory for engineering TAL effectors, including designed TALENs, and... Daniel Voytas Lab plasmids CRISPR plasmids The Joung Lab has developed three platforms for engineering...pages describing these reagents are provided below: Joung Lab REAL Assembly TALEN Kit Individual REAL TALE... -
CRISPR History and Development for Genome Engineering
TypeCollection...Welch MM, Sousa AA, Harrington LB, Sternberg SH, Joung JK, Yildiz A, Doudna JA. 2017. Enhanced proofreading...: 26456817 Fu Y, Sander JD, Reyon D, Cascio VM, Joung JK. 2014. Improving CRISPR-Cas nuclease specificity...Pattanayak V, Prew MS, Tsai SQ, Nguyen NT, Zheng Z, Joung JK. 2016. High-fidelity CRISPR-Cas9 nucleases with...Gonzales AP, Li Z, Peterson RT, Yeh JR, Aryee MJ, Joung JK. 2015. Engineered CRISPR-Cas9 nucleases with ...Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F. ... -
TALEN Plasmids and Kits
TypeCollection...in multiple organisms. Dan Voytas Adam Bogdanove Joung Lab TAL Effector Engineering Reagents Assembly via...ligation. Validated in zebrafish somatic cells. Keith Joung Zhang Lab TALE Toolbox PCR/Golden Gate cloning method... cloning (LIC). Validated in human cells. Veit Hornung Musunuru/Cowan Lab TALEN Kit Kit comprised of 834... and mouse pluripotent stem cells. 48706 pTAL7b Joung Lab REAL Assembly TALEN Kit 49042 EMM65 Bradley ... -
Zinc Finger Consortium Reagents
TypeCollection...deposited by Zinc Finger Consortium members like the Joung Lab, Voytas Lab, and Wolfe Lab... Consortium Reagents You may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids Scot Wolfe...zinc finger technology. Consortium members Keith Joung and Daniel Voytas have deposited at Addgene various... -
TALEN Expression Vectors
TypeCollection...purchased together with the Joung Lab Individual REAL TALE Repeat Plasmids in the Joung Lab REAL Assembly TALEN... REAL-Fast and FLASH You may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids CRISPR plasmids... -
Individual REAL TALE Repeat Plasmids
TypeCollection...may also like... Keith Joung Lab plasmids Daniel Voytas Lab plasmids The Joung Lab recently described ...available individually or as a set as part of the Joung Lab REAL Assembly TALEN Kit , which also includes... -
Microbiology Resources
TypeCollection...interest, including bacteria, viruses, protozoa, fungi, and more. ...bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below for the species you work with...Plasmids for Cyanobacteria Cyanobacteria Plasmids for Fungi Species Aspergillus sp. Cryptococcus sp. Plasmids... -
TALEN Guide
TypeCollection...best-selling kit in Addgene’s history. Dr. Keith Joung’s lab at Massachusetts General Hospital also recently...serial ligation protocol to assemble arrays. Dr. Joung, co-founder of the Zinc Finger Consortium with Dr...Sander JD, Cade L, Khayter C, Reyon D, Peterson RT, Joung JK, Yeh JR. Nat Biotechnol. 2011 Aug 5;29(8):697... -
Zhang Lab CRISPR Page
TypeCollection...mutated genes in lung adenocarcinoma. Delivery of a single AAV vector ( AAV-KPL ) in the lung generated loss-of-function...complex. Konermann S*, Brigham MD*, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg... -
Zebrafish Plasmid Collection
TypeCollection...RNA-Guided Nuclease (RGN) expression plasmids - Keith Joung Lab CRISPR/Cas9-based conditional mutagenesis in...model organism and to foster advanced training of young scientists in Latin America. The Zebrafish Book ... -
CRISPR References and Information
TypeCollection...reference genomes, including animals, plants, bacteria, fungi, protists, and viruses. Developed by the Joachim... -
Feng Zhang Multiplexed Overexpression of Regulatory Factors (MORF) Collection
TypeCollection...transcription factor atlas of directed differentiation. Joung J, Ma S, Tay T, Geiger-Schuller KR, Kirchgatterer... -
Cancer Research Plasmids and Resources
TypeCollection...publications, focused on somatic variants found in lung adenocarcinoma as well as variants found across ... -
CRISPR Plasmids - Zebrafish
TypeCollection... In vitro transcription none, need Cas9 plasmid Joung Do you have suggestions for other plasmids that ...