Skip to main content
Addgene

We narrowed to 10 results for: HA tag

Showing: 1 - 10 of 10 results
  1. Molecular Biology Reference

    Type
    Guide
    ...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...nucleotides. Epitope tags on the other hand are commonly used in molecular cloning to tag a gene within a ...random incorporation of modified, fluorescently tagged bases onto the growing DNA strand in addition to...T, C, or G nucleotide. The 4 standard bases are tagged with a different fluorophore so they can be distinguished...when the polymerase incorporates a fluorescently tagged nucleotide. Because these special bases do not ..., the reaction is halted once the fluorescently tagged base is incorporated. Sanger sequencing requires...because the ultimate goal is to have a fluorescently tagged nucleotide at each position in the DNA sequence...
  2. Sequencing Primers

    Type
    Guide
    ...forward primer HA-F TACCCATACGACGTCCCAGA HA tag, forward primer HA-R TCTGGGACGTCGTATGGGTA HA tag, reverse primer...Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F CGTTGGCTACCCGTGATATT 3' end...primer you need? Email us at [email protected] Addgene has used a number of primers for sanger sequence verification...GGTGGTAATGCCATGTAATATG (Stratagene) S. cerevisiae GAL10 promoter, forward primer Gal4 N-term GAGTAGTAACAAAGGTCAA 3' end... primer T7 TAATACGACTCACTATAGGG T7 promoter, forward primer T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator...Reverse ACCGAGGAGAGGGTTAGGGAT (Invitrogen) V5 epitope, reverse primer WPRE-R CATAGCGTAAAAGGAGCAACA 5' end...
  3. CRISPR Guide

    Type
    Guide
    ...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system - co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...genetic modification ). Browse Plasmids: Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...Loci Using Fluorophores CRISPR imaging has numerous advantages, including the simplicity of gRNA design...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...
  4. Cloning

    Type
    Guide
    ...DNA that already has restriction sites on either side of it into any plasmid that has the same sites in...plasmids have been made with different promoters, tags and fluorescent proteins. Thus, you can clone your...biology techniques (such as fusing it with different tags, putting it under a variety of promoters and into...clonase (creating an entry clone). The entry clone now has recombined attL sites flanking your DNA fragment ...fragment of interest. Now that your DNA fragment has been cloned into a donor plasmid, it can be rapidly shuttled...into a donor plasmid (or acquire one that already has your gene into it) and then using bacterial recombination..., such as restriction cloning, once your project has been completed via gateway cloning. Back to Top TOPO...
  5. Optogenetics Guide

    Type
    Guide
    ...function. TULIPs Tunable light-inducible dimerization tags (TULIPs), plasmids allow cloning of protein coding...sequences with GFP-LOVpep, cpPDZ, ePDZb and ePDZb1 as tags. pDawn/pDusk Blue-light photoreceptor for light-...turning on and off the light source. Optogenetics has been broadly applied to study the physiology of the...channel. ChR2 is preferred over ChR1 because ChR2 has higher conductance at physiological pH and trafficks...Depolarizing) ChR Variants. The optogenetic toolbox has been expanded by scientists through both the identification...heterodimerization can reconstitute the protein. This principle has also permitted the design of synthetic two-part transcription...Phytochrome, cryptochrome, and LOV (light oxygen voltage)-based systems have been used in many experimental...
  6. Plan Your Experiment

    Type
    Guide
    ...such as generating a point mutation or inserting a tag Cas9 (or Cas9 nickase); Base editor Single (or dual...large percentage of DSBs are still repaired by NHEJ. How do you determine that your desired edit has occurred...Cas9-gRNA ribonucleoprotein (RNP) complexes are advantageous due to the transient Cas9 expression. The table...: Provides a semi-quantitative readout of the percentage of alleles that have been mutated within a mixed...
  7. Antibody Guide

    Type
    Guide
    ...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...
  8. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...genome can occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending... well-characterized and extensively studied, and has a broad tissue tropism. Table 1 gives a summary of...across a broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue... tropism towards specific cell types of interest has been to create and test capsid libraries with random...systemic capsids. A systemic capsid is a capsid that has been engineered to have enhanced function after intravenous...naturally cross the BBB. The Viviana Gradinaru lab has developed a number of systemic rAAV vectors that ...preps . AAV retrograde (AAVrg) Directed evolution has also been employed to engineer an rAAV serotype variant...
  9. Adenovirus Guide

    Type
    Guide
    ...immune response has become a disadvantage for the use of rAdV vectors in gene therapy but has, however, proven...response quickly, which has limited their use in therapeutic applications. However, this has also made them the...the human population has been exposed to at least one human AdV serotype and has developed a serotype-... digest patterns to determine that the transgene has been inserted into the adenoviral backbone plasmid...other immune-modulatory molecules. Another strategy has been to use oncolytic rAdV vectors, which are replication-competent... of spontaneous reversion to RCAs, although this has been reduced by providing the E1 gene in trans within... adenovirus (RCA) Mutated adenoviral vector that has the ability to replicate and reproduce within host...
  10. Lentiviral Vector Guide

    Type
    Guide
    ...Retroviridae family. Infection with lentiviruses has a long incubation period that eventually leads to... genes, mutations, or treatments into cells, and has been widely used in the research community for decades...VSV-G is by far the most common envelope gene, as it has a wide range of infectivity across many cell types...their stable expression and wide tropism. Addgene has an extensive collection of lentiviral CRISPR libraries...information (including tropism and viral genome percentage) and resources on viral safety. Resources and...
Showing: 1 - 10 of 10 results