Skip to main content

We narrowed to 10 results for: HA-tags

Showing: 1 - 10 of 10 results
  1. Sequencing Primers

    Type
    Guide
    ...promoter Forward HA-F TACCCATACGACGTCCCAGA HA tag Forward HA-R TCTGGGACGTCGTATGGGTA HA tag Reverse HAT GAGGAGCACGCTCATGCCCAC...GAGGAGCACGCTCATGCCCAC Histidine affinity tag Forward hGH-PA-R CCAGCTTGGTTCCCAATAGA Human growth hormone terminator...promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc tag Forward Neo-F CGTTGGCTACCCGTGATATT 3' end of neomycin...sequencing (NGS) for plasmid verification, Addgene has used a number of primers for Sanger sequence verification...BGH-R TAGAAGGCACAGTCGAGG Bovine growth hormone terminator Reverse CMV Forward CGCAAATGGGCGGTAGGCGTG Human...promoter Forward T7 TAATACGACTCACTATAGGG T7 promoter Forward T7 Terminal GCTAGTTATTGCTCAGCGG T7 terminator ...Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse BGH-R TAGAAGGCACAGTCGAGG Bovine...
  2. Molecular Biology Reference

    Type
    Guide
    ...prokaryotes. Common Epitope Tags Tag Amino Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL...DNA-binding protein has some flexibility in the recognition sequence. Epitope tags, on the other hand,...random incorporation of modified, fluorescently-tagged bases during in vitro DNA replication in addition...nucleotides. The four standard bases (dNTPs) are tagged with a different fluorophore so they can be distinguished...distinguished from one another. These tagged dNTPs also lack a binding site for the next nucleotide (denoted...because the ultimate goal is to have a fluorescently-tagged nucleotide at each position in the DNA sequence...Like Sanger, NGS utilizes modified, fluorescently-tagged nucleotides. During Illumina NGS, a long piece ...
  3. CRISPR Guide

    Type
    Guide
    ...DNA. The system can use common tags, like 3xFLAG-tag, PA, and biotin tags, or an anti-Cas9 antibody. The...in mammalian cells include: SunTag system — co-expression of epitope-tagged dCas9 and antibody-activator...acid, turn a promoter on/off, or add small protein tags. Precise Modifications Using Homology Directed Repair...Plasmids: Double-Strand Break (Cut) , Endogenous Tagging CRISPR Base Editing To overcome low HDR efficiency...Loci Using Fluorophores CRISPR imaging has numerous advantages, including the simplicity of gRNA design...also be fused to the gRNA to recruit fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR ...dCas9s (e.g. S. pyogenes dCas9 and S. aureus dCas9) tagged with different fluorescent proteins or by fusing...
  4. Molecular Cloning Techniques

    Type
    Guide
    ...DNA that already has restriction sites on either side of it into any plasmid that has the same sites in...Gateway destination vectors with different promoters, tags, selection markers, and fluorescent proteins to ...clonase, creating an entry clone. The entry clone now has recombined attL sites flanking your DNA fragment ...into a donor plasmid or acquire one that already has your gene in it. Then you can use bacterial recombination..., such as restriction cloning, once your project has been completed via Gateway cloning. Addgene's collection... pre-cut, linear, cloning-ready TOPO vector that has a DNA topoisomerase I covalently bound to the phosphate...base pairs. Anything shorter than 200 base pairs has the potential to be completely degraded by the 5'...
  5. Optogenetics Guide

    Type
    Guide
    ...light-inducible dimerization tags; proteins fused to LOVpep reversibly dimerize with PDZ tags (cpPDZ, ePDZb, or ...turning on and off the light source. Optogenetics has been broadly applied to study the physiology of the...channel. ChR2 is preferred over ChR1 because ChR2 has higher conductance at physiological pH and traffics...traffics well to the membrane. The optogenetic toolbox has been expanded by scientists through both the identification...heterodimerization can reconstitute the protein. This principle has also been applied to generate two-part transcription...activation wavelengths, which may have advantages or disadvantages depending on the equipment available ...activity. Phytochromes, cryptochromes, light oxygen voltage (LOV), and other photosensitive domains have been...
  6. Antibody Guide

    Type
    Guide
    ...directly to the sdAb, or by using a secondary against a tag, such as His, incorporated in the sdAb. sdAbs can... immune response to it. Once the immune response has developed, the antibodies are collected, tested against...epitopes on constant regions of other antibodies. This has useful research applications, and is covered in the...exist as monomers. Each antibody class therefore has a valency, or number of binding sites available per...of antibodies multiplied by two, as each antibody has two binding sites. Isotype Description Configuration... must be able to detect if and where an antibody has bound. Signaling molecules , proteins that emit a...to avoid confusing data. Check that your machine has appropriate lasers and filters for each fluorophore...
  7. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...genome can occur, although at a low frequency which has been estimated to range from 0.01% to 3% depending... well-characterized and extensively studied, and has a broad tissue tropism. Table 1 gives a summary of...across a broad range of cell types in vivo. AAV-DJ has been optimized further for specific cell and tissue... tropism towards specific cell types of interest has been to create and test capsid libraries with random...systemic capsids. A systemic capsid is a capsid that has been engineered to have enhanced function after intravenous...naturally cross the BBB. The Viviana Gradinaru lab has developed a number of systemic rAAV vectors that ...preps . AAV retrograde (AAVrg) Directed evolution has also been employed to engineer an rAAV serotype variant...
  8. Adenovirus Guide

    Type
    Guide
    ...immune response has become a disadvantage for the use of rAdV vectors in gene therapy but has, however, proven...response quickly, which has limited their use in therapeutic applications. However, this has also made them the...the human population has been exposed to at least one human AdV serotype and has developed a serotype-... digest patterns to determine that the transgene has been inserted into the adenoviral backbone plasmid...other immune-modulatory molecules. Another strategy has been to use oncolytic rAdV vectors, which are replication-competent... of spontaneous reversion to RCAs, although this has been reduced by providing the E1 gene in trans within... adenovirus (RCA) Mutated adenoviral vector that has the ability to replicate and reproduce within host...
  9. Plan Your Experiment

    Type
    Guide
    ...specific genomic edits, like point mutations or small tag insertions, by copying from a DNA donor template ...contain your desired edit. Each of these methods has their own considerations. Which one to use will come...lentiviral preps . AAV vectors AAV vectors offer some advantages for viral vector delivery. Both lentiviral and... if you provided a homology template, a large percentage of DNA breaks will be repaired by NHEJ instead...
  10. Lentiviral Vector Guide

    Type
    Guide
    ...Retroviridae family. Infection with lentiviruses has a long incubation period that eventually leads to... genes, mutations, or treatments into cells, and has been widely used in the research community for decades...VSV-G is by far the most common envelope gene, as it has a wide range of infectivity across many cell types...their stable expression and wide tropism. Addgene has an extensive collection of lentiviral CRISPR libraries...information (including tropism and viral genome percentage) and resources on viral safety. Resources and...
Showing: 1 - 10 of 10 results