Skip to main content
Addgene

Enter a sequence to perform a BLAST-based search of the Addgene plasmid sequence database.

Information

In Category

We narrowed to 6 results for: PHI-1;

Showing: 1 - 6 of 6 results

  1. Sequencing Primers

    Type
    Guide
    ... CMV immediate early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter...end of LexA DNA binding domain, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC...end of Drosophila mini-white gene, reverse primer pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter... primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer Alpha-factor...Forward CTCTGAATACTTTCAACAAGTTAC (Invitrogen) Drosophila heat shock promoter, forward primer EF-1a Forward...primer MT Forward CATCTCAGTGCAACTAAA (Invitrogen) Drosophila metallothionein promoter, forward primer MMLV-F...

  2. CRISPR Guide

    Type
    Guide
    ... most popular genome engineering approach. Figure 1: Overview of the basic CRISPR mechanism Engineered...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

  3. Molecular Biology Reference

    Type
    Guide
    ...Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96...) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 Delta-lacX74 recA1 ...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Delta(lac- proAB) [F ...use, dilute your antibiotic into your LB medium at 1:1,000. For example, to make 100 mL of LB/ampicillin...Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZDeltaM15 Delta-lacX74 recA1 araDelta139 D(ara-leu)7697...

  4. Optogenetics Guide

    Type
    Guide
    ...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...concept of optogenetics. 2012 Prog Brain Res. 196: 1-28. PMID 22341318 Gradinaru V, Zhang F, Ramakrishnan...diversifying and extending optogenetics. Cell. 196:1-28. PMID 20303157 Han X, Boyden ES. 2007 Multiple-...Limitations and Future Developments. Exp Physiol. 96(1): 19–25. PMID 20621963 Mattis J, Tye KM, Ferenczi ... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological...

  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...Skeletal muscle AAV1, AAV6, AAV7, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many...

  6. Promoters

    Type
    Guide
    ...Strong mammalian promoter from human elongation factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter...promoter for small RNA expression UAS Specific Drosophila promoter containing Gal4 binding sites Bacterial...
Showing: 1 - 6 of 6 results