We narrowed to 7 results for: PHI-1;

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward...CGTCAGCAGAGCTTCACCATTG 3' end of LexA DNA binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward... MT1-F GCTGTCCTCTAAGCGTCACC Mouse metallothionein 1 promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse... 5' end of Drosophila mini-white gene Reverse pCasper-hs GCAACTACTGAAATCTGCCAAG Drosophila Hsp70 promoter...35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG Drosophila Actin 5C promoer Forward Alpha-factor TACTATTGCCAGCATTGCTGC...Reverse Ecdysone Forward CTCTGAATACTTTCAACAAGTTAC Drosophila heat shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC...mCherry Reverse MT Forward CATCTCAGTGCAACTAAA Drosophila metallothionein promoter Forward MMLV-F ATCAGTTCGCTTCTCGCTTC...

... or coding strand of the transcribed gene (Figure 1). The coding strand is the DNA strand that encodes...that is transcribed by the RNA polymerase. Figure 1: Simplified promoter region during transcription. ...Mammalian Strong promoter from human elongation factor 1 alpha PGK Constitutive Mammalian Promoter from phospholycerate... Ac5 Constitutive Insect Strong promoter from Drosophila actin 5c gene Gal4/UAS Specific Insect Requires...regulatory element and yeast Gal4 gene; often used in Drosophila Polyhedrin Constitutive Insect Strong promoter...

...Invitrogen F- Phi80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17(rk-, mk+) phoA supE44 thi-1 gyrA96 relA1...StrR ) xyl-5 λ- leu mtl-1 Top10 Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZM15 Δ-lacX74 recA1 araD139... DNA fragments of interest, such as genes. Figure 1: Creation of recombinant DNA. Working with Plasmids...Addgene; Promega e14-(McrA-) recA1 endA1 gyrA96 thi-1 hsdR17(rK- mK+) supE44 relA1 Δ(lac- proAB) [F traΔ36...Survival Invitrogen F- mcrA Δ(mrr-hsdRMS-mcrBC) Phi80lacZΔM15 Δ-lacX74 recA1 araΔ139 D(ara-leu)7697 galU galK...

...changing the target sequence present in the gRNA. Figure 1: Overview of the basic CRISPR mechanism. CRISPR was...from Staphylococcus aureus ) has a coding sequence ~1 kb shorter than SpCas9 while retaining the same basic...lentiviral transfer vectors (Figure 8B). Libraries come in 1-vector systems, in which Cas9 is included in the gRNA-containing...efficiency and fidelity. Nature Communications , 13 (1), 1425. PMID: 35301321 Edraki, A., Mir, A., Ibraheim...interrogation by SpRY-Cas9. Nature Communications , 15 (1), 3663. PMID: 38688943 Hsu, P. D., Scott, D. A., Weinstein...increase its specificity. Nature Communications , 9 (1). PMID: 30082838 Maddalo, D., Manchado, E., Concepcion...CRISPR-Cas9 with Bacteriophage Proteins. Cell , 168 (1–2), 150-158.e10. PMID: 28041849 Sakuma, T., Nishikawa...

...gene, and a terminator, as in Figure 1). Next, up to six Level 1 modules can be assembled into a Level...consists of three sets of cloning vectors (Level 0, 1, and 2) which can be used in successive assembly steps... 0 parts are directionally assembled into a Level 1 vector creating a single transcriptional unit (for...maintain the final plasmid after transformation. Figure 1: Overview of the MoClo Toolkit components and assembly...Genome Engineering, CRISPR, Mammalian Expression, Drosophila John Doench 180-plasmid toolkit for rapid creation...

...algae Chlamydomonas reinhardtii . Channelrhodopsin-1 (ChR1) is excited by blue light and permits nonspecific...based on the LOV2 domain of Avena sativa phototropin 1 LOVETRAP reversibly sequester and release proteins...diversifying and extending optogenetics. Cell, 141 (1), 154–165. https://doi.org/10.1016/j.cell.2010.02.037...limitations and future developments. Exp Physiol, 96 (1), 19–25. https://doi.org/10.1113/expphysiol.2009.051961...Biol, 1408 , 141–165. https://doi.org/10.1007/978-1-4939-3512-3_10 PMID: 26965121 Yizhar, O., Fenno, L... in model organisms like mice, zebrafish, and Drosophila. These tools have been instrumental in neurological...

...replication and also act as signals for packaging. Figure 1: Wild-type AAV genome. Created with BioRender.com....extensively studied, and has a broad tissue tropism. Table 1 gives a summary of the tropism of AAV serotypes, indicating...AAV5, AAV8 Skeletal muscle AAV1, AAV8, AAV9 Table 1: Summary of tissue tropism displayed by different ...transgene, but also at a very low efficiency (less than 1% of wild-type). Another split AAV method which has...vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell...inherited retinal disease, spinal muscular atrophy, hemophilia A and B, and Duchenne muscular dystrophy. Many...