Skip to main content
Addgene

We narrowed to 209 results for: PHI-1;

Showing: 1 - 20 of 209 results
  1. Quick Guide to Working with Drosophila Part 3: Genome Engineering in Flies

    Type
    Blog Post
    ... References 1. J. R. Bateman, et al. Site-Specific Transformation of Drosophila via PhiC31 Integrase-Mediated... you’d like to use to generate your new fly line: 1. Where would you like the gene to be incorporated ...control exactly in which locus your transgene ends up (1): Random insertion has the advantage that you can...earlier, even genes not found in Drosophila can be studied. Using a Drosophila cell line, I’ve studied a transcription...described the fundamentals of how to work with Drosophila as an experimental model organism. I then described...your flies will be ready for experimentation. Drosophila are amenable to many different kinds of experimental...can be employed to look at oxygen consumption. Drosophila are also used in cancer research (3). The sky...
  2. Quick Guide to Working with Drosophila Part 2: Controlling Gene Expression in Flies with Gal4/UAS

    Type
    Blog Post
    ... activation system co-opted from yeast (1). It is a Drosophila geneticist’s main workhorse to turn genes...Duffy, GAL4 System in Drosophila : A Fly Geneticist’s Swiss Army Knife, Genesis 34, 1–15 (2002).PubMed PMID...A Versatile Toolkit for Gene Expression in Drosophila, 3, 1–10 (2015). PubMed PMID: 21356876. 5. J. Chow...he still reads “#” as a “pound symbol”. References 1. A. H. Brand, N. Perrimon, Targeted gene expression...second post in our quick guide to working with Drosophila, you’ll learn how to maniupate expression of ...be overexpressed or knocked down. To do this, Drosophila geneticists use the Gal4/UAS system. This incredibly...had nearly a decade of experience working with Drosophila as an experimental system. Jon enjoys studying...
  3. Quick Guide to Working with Drosophila Part 1: Getting Started with Flies

    Type
    Blog Post
    ...Recombination in Drosophila Learn about Cre-Lox Resources on Addgene.org Find Drosophila Plamids Drosophila CRISPR... ortholog in the Drosophila genome? Continue reading and I’ll show you how Drosophila can be used to push...favorite gene (YFG) in Drosophila (and even if there’s not!) the wealth of Drosophila genetic tools available..., and overexpress YFG in a Drosophila cell line. Knock downs in Drosophila cell lines are extremely effective...your research in new and exciting directions. Drosophila are very easy to manipulate genetically and have... second post will detail a major tool used by Drosophila geneticists (the Gal4/UAS system), and the third... how you can make your own mutant flies. Find Drosophila Resources at Addgene The birds and the bees ...
  4. CRISPR Plasmids - Drosophila

    Type
    Collection
    ...Bullock and Port 49411 pCFD4-U6:1_U6:3tandemgRNAs dU6:1 and dU6:3 BbsI Injection or in vitro transcription... , Harrison , Wildonger 49408 pCFD1-dU6:1gRNA dU6:1 BbsI Injection or in vitro transcription Virmilion... CRISPR Drosophila CRISPR Plasmids: Drosophila Browse CRISPR...designed for use in Drosophila and other insects. CRISPR...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...CRISPR plasmids have been designed for use in Drosophila and other insects. Cut Fully functional CRISPR...
  5. Immunology Research Plasmids and Resources

    Type
    Collection
    ...IGHDY1 IGHD1-1 immunoglobulin heavy diversity 1-1 IGHD11 IGHD1-14 immunoglobulin heavy diversity 1-14 (non-...IGHV6-1 immunoglobulin heavy variable 6-1 IGHV61, VH IGHV7-4-1 immunoglobulin heavy variable 7-4-1 IGHV7...defensin, alpha 1 DEF1, DEFA2, HNP-1, HP-1, MGC138393, MRS DEFA3 defensin, alpha 3, neutrophil-specific DEF3... TAPBP-R, TAPBPR THBS1 thrombospondin 1 THBS, THBS-1, TSP, TSP-1, TSP1 TRPC4AP transient receptor potential...variable 2-8 IGLV28, V1-2 IGLV3-1 immunoglobulin lambda variable 3-1 IGLV31, V2-1 IGLV3-10 immunoglobulin lambda...NCC-1, NCC1, SCYA13, SCYL1 CCL14 chemokine (C-C motif) ligand 14 CC-1, CC-3, CKb1, FLJ16015, HCC-1, HCC...
  6. CRISPR Pooled gRNA Libraries

    Type
    Collection
    ...aeruginosa PA14 234855 (Set 1) 1000000254 Inhibition P. aeruginosa X. Liu NA 1 5,981 (Set 1) 5,971 (Set 2) CHyMErA... Human Doench 3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313...Version 1 1000000069 Knockout Human Moffat 3rd 12 176,500 Toronto KnockOut - Version 3 90294 (1 plasmid...Libraries 153101-153106 Knockout Yeast Borodina N/A 1 Varies Bovine CRISPR Knockout Libraries 213927, 213928...pgRNAs 1,718 Broad GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and...Root 3rd 4 76,441 Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and...and Root 3rd 4 3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and...
  7. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ...Function PI AV-1-49531P 100040-AAV1 pAAV.hSyn1.Twitch2B.WPRE.SV40 Biosensor Oliver Griesbeck AV-1-50942 50942...Tobias Rose AV-1-PV2723 98929-AAV1 pAAV.hSyn.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2724 98931... Looger AV-1-PV2725 98932-AAV1 pAAV.CAG.Flex.iGluSnFr.WPRE.SV40 Biosensor Loren Looger AV-1-PV2816 100835... Kim AV-1-PV2817 100839-AAV1 pAAV.CAG.Flex.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2818 ... Kim AV-1-PV2819 100833-AAV1 pAAV.Syn.Flex.GCaMP6f.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2820 ... Kim AV-1-PV2821 100845-AAV1 pAAV.Syn.Flex.GCaMP6s.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2822 ...Douglas Kim AV-1-PV2823 100841-AAV1 pAAV.Syn.GCaMP6m.WPRE.SV40 Biosensor GENIE, Douglas Kim AV-1-PV2824 100843...
  8. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Fawzi 127194 RP1B FUS 1-163 QQ4xSS #1 FUS His T7 ALS Nicolas Fawzi 127195 RP1B FUS 1-163 QQ4xSS #2 FUS His... type 1 scFv [L24/1] ITPR1 CMV Spinocerebellar ataxia James Trimmer 206790 IP3 receptor, type 1 scFv [...Cookson 13321 pGEX5X.1 PINK1 WT PINK1 GST tac Parkinson's Mark Cookson 13322 pGEX5X.1 PINK1 KD PINK1 GST... His, V5 EF-1 alpha Parkinson's Mark Cookson 25081 pDEST51-LRRK2-R1441C LRRK2 His, V5 EF-1 alpha Parkinson's... His, V5 EF-1 alpha Parkinson's Mark Cookson 25083 pDEST51-LRRK2-R1441H LRRK2 His, V5 EF-1 alpha Parkinson's...Cookson 29350 pGEX-5X-1-DJ1-WT PARK7 GST tac Parkinson's Mark Cookson 29351 pGEX-5X-1-DJ1-D149A PARK7 GST...Cookson 29352 pGEX-5X-1-DJ1-E64D PARK7 GST tac Parkinson's Mark Cookson 29353 pGEX-5X-1-DJ1-M26I PARK7 GST...
  9. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Brown 11908 pEGFP-N1 alpha-actinin 1 Actin Filaments alpha-actinin 1 EGFP Carol Otey 27676 Cortactin-pmCherryC1...Huttenlocher 11908 pEGFP-N1 alpha-actinin 1 Focal Adhesions alpha-actinin 1 EGFP Carol Otey 31923 pPaxillin-PSmOrange...Autophagosome Sequestosome-1 EGFP Noboru Mizushima 38272 pMXs-IP GFP-WIPI-1 Autophagosome WIPI1 EGFP Noboru...apparatus eNOS(1-33) CFP Alexandra Newton 36205 pmTurquoise2-Golgi Golgi apparatus B4GALT1(1-61) mTurquoise2...Filaments Utrophin (aa# 1-261) GFP William Bement 26740 mCherry-UtrCH Actin Filaments Utrophin mCherry ... Shirihai 158003 pCMV-mGold-CAF1-C-10 Nucleus CAF-1 mGold Francois St-Pierre 27705 CAV1-mCherry Caveolae...COXIV-COX8-dL5-2XG4S-mCer3 Mitochondria COX IV-derived (1-22 aa) import sequence and COX VIII signal peptide...
  10. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...190293 Anti-AMIGO-1 [L86/14] AMIGO-1 Mouse Mouse IgG2a 190294 Anti-AMIGO-1 [L86/2] AMIGO-1 Mouse Mouse IgG2a...ATPase 1 [L60/4R-2b] Copper ATPase 1 Human Mouse IgG2b 206648 Anti-AMIGO-1 [L86/33R-2b] AMIGO-1 Mouse ...channel [L6/60R-1] Slo1 K+ channel Mouse Mouse IgG1 206695 Anti-AMIGO-1 [L86/33R-1] AMIGO-1 Mouse Mouse IgG2a...Anti-Olig1 [N149/25R-1] Olig1 Mouse Mouse IgG1 206702 Anti-Neurexin-1-Beta [N170A/1R-1] Neurexin-1-Beta Human Mouse...222160 Beclin-1 [N248A/15R] Beclin-1 Mouse Mouse IgG2a 222161 Beclin-1 [N248A/22R] Beclin-1 Mouse Mouse ...Mouse Mouse 190534 Neurexin-1-Beta scFv [N170A/1] N170A/1 scFv Neurexin-1-Beta Human Mouse 190535 PSD-...Mouse 206755 IP3 receptor, type 1 scFv [L24/1] L24/1 scFv IP3 receptor, type 1 Rat Mouse 206756 VSP scFv [...
  11. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...AdEasier®-1 cells (strain) - Bacterial strain that contains AdEasy®-1 plasmid...N-terminal Myc tag for mammalian expression pGEX-4T-1-3xMyc - Bacterial vector for Myc tag pETcon(-) - Yeast...PGKpuro2ABFP - For retroviral delivery of one sgRNA pMKO.1 GFP - Retroviral shRNA expression Retroviral backbones...expression under a CMV promoter pAdEasy®-1 - Recombine plasmids from the shuttle... Tet-inducible lentiviral shRNA expression pLKO.1 - TRC cloning vector - Lentiviral shRNA expression...driven puromycin Hygromycin Mammalian, Varies pLKO.1 hygro - Lentiviral shRNA expression lentiCRISPRv2 ...lentiSAMv2 - Lentiviral sgRNA cloning backbone pLKO.1-blast - 3rd gen lentiviral backbone for cloning and...
  12. Cre-lox system

    Type
    Collection
    ...Cre-GFP fusion EF-1 alpha Mammalian Sauer 11923 pBS598 EF1alpha-EGFPcre Cre-EGFP fusion EF-1 alpha Mammalian...mCherry coexpression EF-1 alpha AAV Deisseroth 55635 pAAV-EF1a-sCre SCre EF-1 alpha AAV Deisseroth 55636...55636 pAAV-EF1a-Cre Cre EF-1 alpha AAV Deisseroth 55638 pAAV-EF1a-vCre VCre EF-1 alpha AAV Deisseroth 59701...) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent on GFP (CRE-DOG) EF-1 alpha...rearrangements: inversion, deletion, and translocation. Figure 1. Recombination outcomes are determined by target site... Mammalian Sauer 11918 pBS513 EF1alpha-cre Cre EF-1 alpha Mammalian Sauer 11919 pBS448 RSV-GFPcre Cre-...11955 pBS505 EF1alpha-EGFPcre* Cre-EGFP fusion EF-1 alpha Mammalian Sauer 11956 pBS594 promoterless EGFPcre...
  13. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose Green fluorescent MBP-based...signalling mechanism. Nat Commun. 2017 Jun 29;8(1):49. Philip Mullineaux Insulin Sensor for Imaging Insulin...of cellular physiology. Nat Commun. 2020 Aug 4;11(1):3881. Adam Cohen Calcium GCaMP6f expression in forebrain...Dynamics in High-Ca Organelles. Cell Chem Biol. 2016 Jun 1. pii: S2451-9456(16)30163-5. Teresa Alonso , Javier... intracellular calcium. Nat Commun. 2021 Dec 9;12(1):7159. Dorus Gadella Calcium Teal genetically encoded...Neurophotonics. 2024 Apr;11(2):024207. doi: 10.1117/1.NPh.11.2.024207. Robert Campbell Calcium Ratiometric...orange-emitting fluorescent proteins. Nat Commun. 2017 Sep 5;8(1):431. Wolf Frommer Calcium Red-, yellow-, or cyan-...
  14. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...Institute ID Tag Protein Structure 87420 PXN-EGFP AICSDP-1 EGFP Paxillin Matrix Adhesions 87421 TUBA1B-mEGFP ...TJP1-mEGFP AICSDP-23 mEGFP Tight junction protein ZO-1 Tight junctions 91565 AAVS1-mEGFP AICSDP-35 mEGFP ...Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP-1 Lysosome 101783 MAP1LC3B-mEGFP AICSDP-25 mEGFP Autophagy-related...101786 ST6GAL1-mEGFP AICSDP-26 mEGFP Sialyltransferase 1 Golgi 109122 NPM1-mEGFP AICSDP-50 mEGFP Nucleophosmin... HIST1H2BJ-mEGFP AICSDP-52 mEGFP Histone H2B type 1-J Histones 109119 CTNNB1-mEGFP AICSDP-47 mEGFP Beta-catenin...Nuclear speckles 159744 DMD-mEGFP AICSDP-55 mEGFP Dystrophin Costameres 159745 TFAM-mEGFP AICSDP-72 mEGFP ...
  15. Validated gRNA Sequences

    Type
    Collection
    ...Mendenhall rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...AMPK alpha 1 H. sapiens GGCTGTCGCCATCTTTCTCC 74374 nick S. pyogenes 26816379 Shaw AMPK alpha 1 H. sapiens...GCCACAAATCAGATTAATTTGGG 64939 tag S. pyogenes 26355004 Mendenhall csr-1 N. crassa GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes...GCATGGGTGATGTCAATGCC 69238 cut S. pyogenes 26480473 Wolfe Kit-1 R. norvegicus CATCTGTGCGGCCGTTGGCT 60969 cut S. pyogenes...TTGATCCAAATTATAACCCG 68896 interfere S. pyogenes 26918244 Lu NDM-1 GGGCAGTCGCTTCCAACGGTTTGATCGTCA 61270 cut S. pyogenes... 60719 activate S. pyogenes 25664691 Gersbach pha-1 C. elegans ATGAATAACTTGATGAACAT 61252 cut S. pyogenes...
  16. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...endogenous repair mechanisms. Cas3 belongs to the Class 1 family of CRISPR systems, the most abundant type found...bacteria and archaea. While abundant in nature, Class 1 systems are largely underutilized compared to their...still separate the individual Cas components. Figure 1: Overview of Cascade-Cas3 mechanism. Created with ...gRNA Vectors gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR...
  17. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...3tandemgRNAs Drosophila Single plasmid for the expression of two gRNAs from Drosophila U6:1 and U6:3 promoters...Lentiviral BsmBI yes, cut S. pyogenes EGFP Ebert pLKO.1-puro U6 sgRNA BfuAI stuffer 50920 Mammalian/Lentiviral...Worm HindIII none S. pyogenes de Bono sgRNA with rpr-1 promoter 48961 Worm EcoRI none S. pyogenes de Bono...Zebrafish BseRI none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin...see plasmid page yes, cut S. pyogenes BFP Kuhn pLKO.1-puro U6 sgRNA BfuAI large stuffer 52628 Mammalian/...Puro Zoldos pX330-U6-Chimeric_BB-CBh-hSpCas9-hGem(1/110) 71707 Mammalian hU6 yes, cut S. pyogenes Draetta...expression of Cas9, dCas9, or dCas9-VP64 along with 1-4 sgRNAs expressed from independent promoters. sgRNAs...
  18. Lentivirus Plasmids

    Type
    Collection
    ...working with lentivirus: these viruses are based on HIV-1, which may require additional lab biosafety procedures...". ID Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puro resistance...plasmid 24150 for hygro resistance. Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid... EGFP coexpression. Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression...article for more similar plasmids. Elledge 21373 pHIV-EGFP 3rd EF-1alpha driven expression of cDNA and...
  19. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous Type II bacterial...separated by short palindromic repeat sequences. (1) The CRISPR array is transcribed to make the pre-CRISPR...engineering, with Type V following in 2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain...enChIP) using CRISPR. Biochem Biophys Res Commun . 439(1):132-6. PMID: 23942116 Gilbert LA, Horlbeck MA, Adamson...CRISPR-Cpf1 using a single crRNA array. Nat Biotechnol . 35(1):31-34. PMID: 27918548... , Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast...
  20. Genetic Code Expansion

    Type
    Collection
    ...Bacterial TAG Farren Isaacs 73545 pEvol-pAcFRS.1.t1 pAcFRS.1.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73547 pEvol-pAzFRS.1.t1 pAzFRS.1.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial...7FTrp) Bacterial TAG Thomas Huber 207639 pEVOL-NBK-1 PylRS M. mazei Pyrrolysine Bacterial Cole DeForest...and tyrU gene replaced by GentR) and release factor 1. Expresses archaeal MjTyrRS/tRNA pair instead. For...Huber 164080 pCMV-MtPylRS (human-opti) PylRS M. thermophila acetyl-lysine Mammalian Tao Liu 164081 pCMV-MfPylRS...Liu 164195 pCMV-MtAcKRS (human-opti) AcKRS M. thermophila acetyl-lysine Mammalian Tao Liu 164196 pCMV-MfBulKRS...
Showing: 1 - 20 of 209 results