Skip to main content

We narrowed to 11 results for: SARS

Showing: 1 - 11 of 11 results
  1. Adenovirus Guide

    Type
    Guide
    ...2021). Adenoviral vector vaccine platforms in the SARS-CoV-2 pandemic . NPJ Vaccines, 6 (1), 97. https:... Common Uses Safety Resources Plasmid Elements Glossary Credits Adenoviruses (AdV) are medium-sized, non-enveloped...virus enters the host cell, and encode proteins necessary for viral DNA replication and host cell manipulation...vectors or simply need a refresher, we've included a glossary at the end! Browse Adenoviral Plasmids Adenovirus... containing the rest of the adenoviral genome necessary for viral production and homology regions for ...containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning and working with...e.g. pAdEasy) — containing the adenoviral genes necessary for viral production. In AdEasy™, the transgene...
  2. CRISPR Guide

    Type
    Guide
    ...detect the presence of infectious organisms (like SARS-CoV-2 ) and genetic mutations. Similar to Cas9 and...Plan Your Experiment Web References PAM Sequences Glossary Publications CRISPR Overview Bacteria have an ...synthetic RNA composed of a scaffold sequence necessary for Cas-binding and a user-defined ∼20-nucleotide...collection are from S. pyogenes unless otherwise noted. Glossary Term Definition Base editor Fusion of a Cas protein...Sequence adjacent to the target sequence that is necessary for Cas enzymes to bind target DNA PCR P olymerase...551 (7681), 464–471. PMID: 29160308 Hess, G. T., Frésard, L., Han, K., Lee, C. H., Li, A., Cimprich, K. ...L., Liu, Z., Brar, G. A., Torres, S. E., Stern-Ginossar, N., Brandman, O., Whitehead, E. H., Doudna, J...
  3. Gamma-Retroviral Vector Guide

    Type
    Guide
    ... Common Uses Safety Resources Plasmid Elements Glossary Credits Gamma-retroviruses are a subtype of retrovirus...types include murine leukemia virus (MLV), murine sarcoma virus (MSV), and feline leukemia virus (FeLV). ...vectors or simply need a refresher, we've included a glossary at the end! Browse retroviral plasmids available...Retroviruses have simpler genomes, containing only the necessary packaging genes, while lentiviruses also contain...packaging genes and the long-terminal repeats (LTRs) necessary for integration. Wildtype gamma-retroviruses contain... contain the gag , pol , and env genes necessary for gamma-retroviral production, and scientists have...containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning and working with...
  4. Lentiviral Vector Guide

    Type
    Guide
    ...long-terminal repeats (LTRs) necessary for integration. Not all of these components are necessary for lentiviral production... Common Uses Safety Resources Plasmid Elements Glossary Credits Lentiviruses are a type of retrovirus ...vectors or simply need a refresher, we've included a glossary at the end! Browse lentiviral plasmids available...by using three separate plasmids encoding the necessary viral genes Safer; replication incompetent by ...containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning and working with... viral production followed by transduction is necessary to properly utilize lentiviral vectors. Some lentiviral...provirus. The U3 (unique 3’) contains sequences necessary for activation of viral genomic RNA transcription...
  5. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... Common Uses Safety Resources Plasmid Elements Glossary Credits Adeno-Associated Viruses (AAV) are small...vectors or simply need a refresher, we've included a glossary at the end! Browse AAV Plasmids Adeno-Associated...plasmid) — containing the Rep and Cap regions necessary for the production and assembly of viral capsids...containing the ccdB gene, a ccdB-resistant strain is necessary. For more information on cloning and working with...efficient AAV replication as it activates the necessary cellular machinery to produce large amounts of... for infection and to express a viral element necessary for RABV trans-synaptic transport. Learn more ...translation and inhibiting cellular anti-viral defenses. Glossary Term Definition Adeno-associated virus (AAV) Wildtype...
  6. Optogenetics Guide

    Type
    Guide
    ...Optogenetics Guide Opsins Glossary of Common Opsins Optical Switches Glossary of Common Optical Switches...chemogenetic systems in our Chemogenetics Guide . Glossary of Common Microbial Opsins and Variants Channelrhodopsins... through engineering, design, and mutagenesis. Glossary of Common Optical Switches UV Receptors BLUF Domains...
  7. Sequencing Primers

    Type
    Guide
    ... Forward pREP Forward GCTCGATACAATAAACGCC Rous sarcoma virus (RSV) promoter Forward pRS-marker CGGCATCAGAGCAGATTGTA...Reverse RCAS-F ACATGGGTGGTGGTATAGCGCTTGCG 3' of Rous sarcoma virus (RSV) env gene Forward Rluc-F CCAGGATTCTTTTCCAATGC...
  8. Molecular Biology Reference

    Type
    Guide
    ... gene from human chromosomal DNA, it would be necessary to isolate a sequence of a few hundred or a few...essential DNA sequences (or plasmid elements) necessary for their intended purpose. When a plasmid exists...
  9. Molecular Cloning Techniques

    Type
    Guide
    ...in the annealed product, ligation is rendered unnecessary. The product may be transformed directly into...
  10. Plan Your Experiment

    Type
    Guide
    ... may work best for your experiment. It may be necessary to optimize your delivery conditions, especially...
  11. Antibody Guide

    Type
    Guide
    ...plasmid-based expression. Monoclonal antibodies are necessary in cases where extreme specificity is important...
Showing: 1 - 11 of 11 results