...natural Cas orthologs include Hsp1Cas9 (from Helicobacter sp. MIT 11-5569 ) and Nme2Cas9 (from Neisseria...paralogs or lncRNAs . Guide RNAs are designed in silico and synthesized (Figure 8A), then cloned in a pooled...fluorescently-tagged RNA-binding proteins (RBPs). Multicolor CRISPR imaging can be achieved by using orthogonal...Streptococcus thermophilus (ST) 3' NNAGAAW Treponema denticola (TD) 3' NAAAAC Additional Cas9s from various species...Wolfe, S. A., Zhang, S., & Pederson, T. (2015). Multicolor CRISPR labeling of chromosomal loci in human ...

...About Una traducción al español de nuestro libro electrónico, CRISPR 101. Close About Overlay Select Antibodies...

...primer CAT-R GCAACTGACTGAAATGCCTC 5' end of chloramphenicol resistance gene, reverse primer CMV Forward...

...for example, the U6 promoter is included in the pSico plasmid to drive shRNA expression. Other features...

...PSAMs, pronounced SAMs). PSAMs are engineered α7 nicotinic acetylcholine receptor (nAChR) domains that respond...

...100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol 25 mg/mL (dissolve in EtOH) 25 µg/mL Hygromycin...