Skip to main content
Addgene
Showing: 1 - 7 of 7 results
  1. Promoters

    Type
    Guide
    ...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible ...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...
  2. Molecular Biology Reference

    Type
    Guide
    ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region... of Replication Plasmids 101: The Promoter Region-Let’s Go Promoters Reference Page Plasmids 101: How ...
  3. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...
  4. Plan Your Experiment

    Type
    Guide
    ...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...activator (such as dCas9-VP64) gRNA(s) targeting promoter elements of target gene Many different activators...dCas9-repressors, gRNAs should be targeted to the promoter driving expression of your gene of interest. For...containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than gRNAs...amplified, PCR products are denatured-renatured, treated with a nuclease that cleaves DNA heteroduplexes...
  5. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor...binding then activates G-proteins to modulate downstream signaling. GPCRs have been shown to be involved...signaling by inhibiting adenylate cyclase and downstream cAMP production. There are currently two Gi DREADDs...AN, Silvagnoli AD, Crespo EL, Schalau R, Gott M, Tree MO, Dunbar GL, Rossignol J, Hochgeschwender U (2025..., Gorantla N, Simkins J, Crespo EL, Ikefuama EC, Tree MO, Prakash M, Björefeldt A, Barnett LM, Lambert...
  6. CRISPR Guide

    Type
    Guide
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...
  7. Cloning

    Type
    Guide
    ...destination plasmids have been made with different promoters, tags and fluorescent proteins. Thus, you can ...different tags, putting it under a variety of promoters and into backbones with different selection cassettes...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation...
Showing: 1 - 7 of 7 results