Skip to main content
Addgene

We narrowed to 11 results for: tre promoter

Showing: 1 - 11 of 11 results
  1. Promoters

    Type
    Guide
    ...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...mammalian promoter PGK Constitutive Mammalian promoter from phospholycerate kinase gene TRE Inducible ...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...
  2. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...
  3. Molecular Biology Reference

    Type
    Guide
    ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region... of Replication Plasmids 101: The Promoter Region-Let’s Go Promoters Reference Page Plasmids 101: How ...
  4. Plan Your Experiment

    Type
    Guide
    ...Cas enzyme and gRNA Species of promoter and expression pattern of promoter for Cas enzyme and gRNA Presence...Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically...such as dCas9-KRAB) or dCas9 gRNA(s) targeting promoter elements of target gene dCas9-KRAB is more effective...activator (such as dCas9-VP64) gRNA(s) targeting promoter elements of target gene Many different activators...dCas9-repressors, gRNAs should be targeted to the promoter driving expression of your gene of interest. For...containing a G nucleotide at position 20 (1 bp upstream of the PAM) may be more efficacious than gRNAs...amplified, PCR products are denatured-renatured, treated with a nuclease that cleaves DNA heteroduplexes...
  5. Gamma-Retroviral Vector Guide

    Type
    Guide
    ...heterologous promoter (usually CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript... to prefer transcription start sites, such as promoters and enhancers. Many times, integration sites are...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope...selection is driven by strong enhancers and active promoters. Nucleic Acids Research , 42 (7), 4257–4269. https...plasmids use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates transcription...stable delivery of various genes, mutations, or treatments into cells, and has been widely used in the research...many approved gamma-retroviral gene therapies to treat disease like cancer or immunodeficiency disorders...
  6. Lentiviral Vector Guide

    Type
    Guide
    ...LTR for self-inactivation LTR Viral Promoter Wildtype Hybrid promoter; 5' LTR is partially deleted and fused...with a heterologous promoter (CMV or RSV). 5' LTR in cis Acts as an RNA pol II promoter; the transcript begins...plasmids include tat , as the 5’ LTR is used as a promoter on the transfer plasmid, and this requires Tat...contains a chimeric 5’ LTR fused to a heterologous promoter (often CMV or RSV), eliminating the need for transactivation... fused to a heterologous enhancer/promoter such as CMV or RSV Table 1. Summary of key differences between...cell lines, VSV-G is often put under an inducible promoter. Depending on the cell type, there are other envelope... mitigated through the use of tissue-specific promoters and envelope genes, and/or with site-specific ...
  7. Chemogenetics Guide

    Type
    Guide
    ...Chemogenetic Plasmids ! Table 4. Common promoters in chemogenetics plasmids Promoter Cell Specificity hSyn1, CaMKIIa...controlled with cell-type specific promoters. Table 4 lists some common promoters found in chemogenetic receptor...binding then activates G-proteins to modulate downstream signaling. GPCRs have been shown to be involved...signaling by inhibiting adenylate cyclase and downstream cAMP production. There are currently two Gi DREADDs...AN, Silvagnoli AD, Crespo EL, Schalau R, Gott M, Tree MO, Dunbar GL, Rossignol J, Hochgeschwender U (2025..., Gorantla N, Simkins J, Crespo EL, Ikefuama EC, Tree MO, Prakash M, Björefeldt A, Barnett LM, Lambert...
  8. CRISPR Guide

    Type
    Guide
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...
  9. Adeno-associated virus (AAV) Guide

    Type
    Guide
    ... proteins, often under strong neuron-specific promoters or neural Cre-dependent expression, to visualize...recombinant adeno-associated virus (scAAV) vectors promote efficient transduction independently of DNA synthesis...nuclear export of RNA and RNA translation, and promotes RNA transcript longevity. Located between WPRE...rAAV vectors is in the field of gene therapy to treat genetic disorders. rAAV vectors are favored over...by the US Food and Drug Administration (FDA) to treat a diversity of diseases such as inherited retinal...therapies are underway and are promising for the treatment of other major diseases such as cystic fibrosis...CRISPR-based genome editing. Packaging the Cas9 from Streptococcus pyogenes (SpCas9) and a gRNA together into an...
  10. Cloning

    Type
    Guide
    ...destination plasmids have been made with different promoters, tags and fluorescent proteins. Thus, you can ...different tags, putting it under a variety of promoters and into backbones with different selection cassettes...restriction site. Because of the relatively long stretches of base pairing in the annealed product, ligation...
  11. Adenovirus Guide

    Type
    Guide
    ... Repeat, serve as self-priming structures that promote primase-independent DNA replication. 3' ITR (RITR... Repeat, serve as self-priming structures that promote primase-independent DNA replication. Homology arms...infectious diseases and prostate cancer. Cancer Treatment Recombinant adenoviral vectors are also being ...
Showing: 1 - 11 of 11 results