XLone-Puro SARS-CoV2 N P2A eGFP-NLS
(Plasmid
#154399)
-
PurposePiggybacTransposon-based tunable and temporal expression control of SARS-CoV2 N and nuclear eGFP
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154399 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneXLone-BSD SARS-CoV2-N P2A mCherry Addgene #154398
- Backbone size w/o insert (bp) 5710
- Total vector size (bp) 7841
-
Vector typeMammalian Expression ; Piggybac
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-CoV2 N Protein
-
Alt nameNucleocapsid
-
SpeciesSARS-CoV2
-
Insert Size (bp)1275
-
Entrez GeneN (a.k.a. GU280_gp10)
- Promoter TRE3G
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NheI or SpeI (not destroyed)
- 5′ sequencing primer gcgcctataaaagagtgctga
- 3′ sequencing primer M13 FWD
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySARS-CoV-2-N was PCR amplified from Addgene plasmid #141391, gift from Dr. Nevan Krogan lab.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
XLone-Puro SARS-CoV2 N P2A eGFP-NLS was a gift from Xiaoping Bao (Addgene plasmid # 154399 ; http://n2t.net/addgene:154399 ; RRID:Addgene_154399)