-
PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 154944 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV2
- Backbone size w/o insert (bp) 4353
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBiPOLES
-
SpeciesSynthetic
-
Insert Size (bp)3072
- Promoter human synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GACTCAGCGCTGCCTCAGTCTG
- 3′ sequencing primer TGTTGCTCCTTTTACGCTATG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The insert contains the fluorescence tag mCerulean3 in between the 2 channelrhodopsins (C-terminal of GtACR2) . Please visit https://www.biorxiv.org/content/10.1101/2020.07.15.204347v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hSyn-BiPOLES-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 154944 ; http://n2t.net/addgene:154944 ; RRID:Addgene_154944) -
For your References section:
BiPOLES is an optogenetic tool developed for bidirectional dual-color control of neurons. Vierock J, Rodriguez-Rozada S, Dieter A, Pieper F, Sims R, Tenedini F, Bergs ACF, Bendifallah I, Zhou F, Zeitzschel N, Ahlbeck J, Augustin S, Sauter K, Papagiakoumou E, Gottschalk A, Soba P, Emiliani V, Engel AK, Hegemann P, Wiegert JS. Nat Commun. 2021 Jul 26;12(1):4527. doi: 10.1038/s41467-021-24759-5. 10.1038/s41467-021-24759-5 PubMed 34312384