-
PurposeExpresses the original SARS-Cov-2 Spike Protein under a CMV Promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173921 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 * |
* Log in to view industry pricing.
Backbone
-
Vector backbonepUC57-Kan
- Backbone size w/o insert (bp) 2539
- Total vector size (bp) 7286
-
Modifications to backbonenone, EcoRV serves as blunt cutter on both ends if integration is desired. LoxP is included for rapid knock-in, after EcoRV digest and re-circularization
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsLB medium with kanamycin
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSARS-2 Spike Protein
-
SpeciesH. sapiens (human), Synthetic; SARS-COV-2
-
Insert Size (bp)4747
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter standard CMV
-
Tag
/ Fusion Protein
- no tags, native protein
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CMV-f CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer M13-rev CAGGAAACAGCTATGAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySynthetic Insert
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Spike was a gift from Andreas Stuermer (Addgene plasmid # 173921 ; http://n2t.net/addgene:173921 ; RRID:Addgene_173921)