Skip to main content

pCMV-Spike
(Plasmid #173921)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173921 Standard format: Plasmid sent in bacteria as agar stab 1 $89 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pUC57-Kan
  • Backbone size w/o insert (bp) 2539
  • Total vector size (bp) 7286
  • Modifications to backbone
    none, EcoRV serves as blunt cutter on both ends if integration is desired. LoxP is included for rapid knock-in, after EcoRV digest and re-circularization
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB medium with kanamycin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-2 Spike Protein
  • Species
    H. sapiens (human), Synthetic; SARS-COV-2
  • Insert Size (bp)
    4747
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter standard CMV
  • Tag / Fusion Protein
    • no tags, native protein

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV-f CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer M13-rev CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Spike was a gift from Andreas Stuermer (Addgene plasmid # 173921 ; http://n2t.net/addgene:173921 ; RRID:Addgene_173921)