Skip to main content

pCMV-Spike
(Plasmid #173921)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 173921 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
DNA 173921-D50 50 μg of DNA in Tris buffer $495 *
DNA 173921-D100 100 μg of DNA in Tris buffer $585 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pUC57-Kan
  • Backbone size w/o insert (bp) 2539
  • Total vector size (bp) 7286
  • Modifications to backbone
    none, EcoRV serves as blunt cutter on both ends if integration is desired. LoxP is included for rapid knock-in, after EcoRV digest and re-circularization
  • Vector type
    Mammalian Expression, Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    LB medium with kanamycin
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SARS-2 Spike Protein
  • Species
    H. sapiens (human), Synthetic; SARS-COV-2
  • Insert Size (bp)
    4747
  • Entrez Gene
    S (a.k.a. GU280_gp02, spike glycoprotein)
  • Promoter standard CMV
  • Tag / Fusion Protein
    • no tags, native protein

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CMV-f CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer M13-rev CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Synthetic Insert

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV-Spike was a gift from Andreas Stuermer (Addgene plasmid # 173921 ; http://n2t.net/addgene:173921 ; RRID:Addgene_173921)