-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 21627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDL171 (pWPI with deletion of 1409 bp XhoI [EMCV IRES GFP] frag)
- Backbone size w/o insert (bp) 9692
-
Vector typeMammalian Expression, Lentiviral, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehOCT4 - 2A - hSOX2 - 2A - hKLF4
-
Alt namePOU5F1
-
Alt namePorcine teschovirus-1 2A peptide
-
SpeciesH. sapiens (human); Porcine teschovirus-1
-
Insert Size (bp)3589
-
GenBank IDBC117435 BC029923 BC013923
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SwaI (not destroyed)
- 3′ cloning site SwaI (not destroyed)
- 5′ sequencing primer GGCACCTCGATTAGTTCTCGAGC
- 3′ sequencing primer AATCCAGAGGTTGATTATCG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Plasmid constructed by Kevin Pawlik
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKP332 (Lenti-OSK1) was a gift from Tim Townes (Addgene plasmid # 21627 ; http://n2t.net/addgene:21627 ; RRID:Addgene_21627) -
For your References section:
Polycistronic lentiviral vector for "hit and run" reprogramming of adult skin fibroblasts to induced pluripotent stem cells. Chang CW, Lai YS, Pawlik KM, Liu K, Sun CW, Li C, Schoeb TR, Townes TM. Stem Cells. 2009 May . 27(5):1042-9. 10.1002/stem.39 PubMed 19415770