-
PurposeConstitutive expression of sgRNA without donor editing template DNA
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 62226 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneTrc99a
- Backbone size w/o insert (bp) 2000
-
Modifications to backboneReplaced Amp with aadA
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA
-
gRNA/shRNA sequenceGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTG
-
SpeciesSynthetic
- Promoter pij23119
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
- 5′ sequencing primer MoClo-F (agcgaggaagcggaagagcg)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTargetF was a gift from Sheng Yang (Addgene plasmid # 62226 ; http://n2t.net/addgene:62226 ; RRID:Addgene_62226) -
For your References section:
Multigene editing in the Escherichia coli genome using the CRISPR-Cas9 system. Jiang Y, Chen B, Duan C, Sun B, Yang J, Yang S. Appl Environ Microbiol. 2015 Jan 30. pii: AEM.04023-14. 10.1128/AEM.04023-14 PubMed 25636838