Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLncEXP
(Plasmid #64865)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64865 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSIREN-RetroQZsGreen
  • Backbone manufacturer
    Clontech
  • Backbone size (bp) 6600
  • Modifications to backbone
    U6 promoter and partial sequence downstream ZsGreen was removed from the backbone.
  • Vector type
    Retroviral
  • Promoter CMV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer gagctggtttagtgaacggtca
  • 3′ sequencing primer cctacaggtggggtctttca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLncEXP was a gift from Lei Sun (Addgene plasmid # 64865 ; http://n2t.net/addgene:64865 ; RRID:Addgene_64865)
  • For your References section:

    De Novo Reconstruction of Adipose Tissue Transcriptomes Reveals Long Non-coding RNA Regulators of Brown Adipocyte Development. Alvarez-Dominguez JR, Bai Z, Xu D, Yuan B, Lo KA, Yoon MJ, Lim YC, Knoll M, Slavov N, Chen S, Chen P, Lodish HF, Sun L. Cell Metab. 2015 May 5;21(5):764-76. doi: 10.1016/j.cmet.2015.04.003. Epub 2015 Apr 23. 10.1016/j.cmet.2015.04.003 PubMed 25921091