Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65566)


Item Catalog # Description Quantity Price (USD)
Plasmid 65566 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    gfap sgRNA
  • gRNA/shRNA sequence
    GTGCGCAACACATAGCACCA (reverse strand)
  • Species
    D. rerio (zebrafish)
  • Entrez Gene
    gfap (a.k.a. cb345, etID36982.3, gfapl, wu:fb34h11, wu:fk42c12, xx:af506734, zgc:110485)
  • Promoter T7

Cloning Information

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT7-gfap-sgRNA was a gift from Jiu-lin Du (Addgene plasmid # 65566 ; ; RRID:Addgene_65566)
  • For your References section:

    Intron targeting-mediated and endogenous gene integrity-maintaining knockin in zebrafish using the CRISPR/Cas9 system. Li J, Zhang BB, Ren YG, Gu SY, Xiang YH, Huang C, Du JL. Cell Res. 2015 Apr 7. doi: 10.1038/cr.2015.43. 10.1038/cr.2015.43 PubMed 25849248