Skip to main content

SS9_RNA
(Plasmid #71656)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 71656 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone manufacturer
    New England Biolabs
  • Backbone size w/o insert (bp) 2564
  • Total vector size (bp) 2584
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SS9 gRNA
  • gRNA/shRNA sequence
    tctggcgcagttgatatgta
  • Species
    Escherichia coli
  • Promoter J23119

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ataagggcgacacggaaatgttgaatactc
  • 3′ sequencing primer tttatttgatgcctggcagttccctactctcgcatgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SS9_RNA was a gift from Ryan Gill (Addgene plasmid # 71656 ; http://n2t.net/addgene:71656 ; RRID:Addgene_71656)
  • For your References section:

    Rapid and Efficient One-Step Metabolic Pathway Integration in E. coli. Bassalo MC, Garst AD, Halweg-Edwards AL, Grau WC, Domaille DW, Mutalik VK, Arkin AP, Gill RT. ACS Synth Biol. 2016 Apr 22. 10.1021/acssynbio.5b00187 PubMed 27072506