-
Purposeimage recycling of VGAT in live neurons
-
Depositing Lab
-
Depositing OrganizationUniversity of California, San Francisco (UCSF)
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 78578-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 78578-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAGGS E/S
- Backbone size w/o insert (bp) 4790
- Total vector size (bp) 7691
-
Modifications to backboneSphI site in the MCS removed because it contains an ATG
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namevGAT-pHluorin C-term
-
Alt nameVGAT-pH
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)3112
-
GenBank IDAF030253.1 AY533296.1
-
Entrez GeneSlc32a1 (a.k.a. Vgat, Viaat)
- Promoter chicken actin
-
Tag
/ Fusion Protein
- superecliptic pHluorin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TAGCTCGAGGTACCGATATC
- 3′ sequencing primer CCTGAGGAGTGAATTGAGCTC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal clone of rat VGAT was from Dr. Robert H. Edwards, University of California San Francisco
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 78578-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 78578-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
vGAT-pH pcaggs SE was a gift from Susan Voglmaier (Addgene plasmid # 78578 ; http://n2t.net/addgene:78578 ; RRID:Addgene_78578) -
For your References section:
Sorting of the vesicular GABA transporter to functional vesicle pools by an atypical dileucine-like motif. Santos MS, Park CK, Foss SM, Li H, Voglmaier SM. J Neurosci. 2013 Jun 26;33(26):10634-46. doi: 10.1523/JNEUROSCI.0329-13.2013. 10.1523/JNEUROSCI.0329-13.2013 PubMed 23804087
Map uploaded by the depositor.
