This website uses cookies to ensure you get the best experience. By continuing the use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

EGFP gRNA (BRDN0000561167)
(Plasmid #80034)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80034 Plasmid sent as bacteria in agar stab 1 $65
Lentiviral Prep 80034-LV Virus (1mL at titer ≥ 1x10⁶ TU/mL)
and Plasmid. More Information
$250

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    lentiGuide-Puro
  • Backbone manufacturer
    Zhang Lab (Addgene plasmid # 52963)
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP
  • gRNA/shRNA sequence
    GGGCGAGGAGCTGTTCACCG
  • Species
    Synthetic
  • Promoter hU6

Cloning Information

Resource Information

Depositor Comments

Note that this plasmid does NOT contain Cas9. It should be used in conjunction with lentiCas9-Blast (Addgene #52962) or otherwise with cell lines already expressing Cas9. Browse the full kinome gRNA library at http://www.addgene.org/pooled-library/broadgpp-human-kinome/ or visit http://www.broadinstitute.org/rnai/public/ for detailed protocols and information.

Information for Lentiviral Prep (Catalog # 80034-LV) ( Back to top )

Purpose

Ready-to-use Lentiviral Prep particles produced from EGFP gRNA (BRDN0000561167) (#80034). In addition to the viral particles, you will also receive purified EGFP gRNA (BRDN0000561167) plasmid DNA.

Lentiviral particles carrying an EGFP sgRNA (BRDN0000561167) and puromycin resistance.

Delivery

  • Volume 1mL
  • Titer ≥1x10⁶ TU/mL
  • Pricing $220 USD for preparation of 1mL virus + $30 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids psPAX2 (plasmid #12260)
  • Envelope pMD2.G (plasmid #12259)
  • Buffer DMEM +10% FBS
  • Selectable Marker Puromycin

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Viral Quality Control

Titering Method:
  • Colony formation assay: A549 cells were transduced with serial dilutions of 80034-LV and treated with puromycin. Puromycin-resistant colonies were expanded for approximately 2 weeks, stained with crystal violet, and counted.
Notes:
  • PCR confirmation of insert: PCR was carried out with primers targeting the hU6 and EF1-alpha promoters. The PCR product was visualized on an agarose gel for size confirmation, purified and the guide sequence was confirmed by Sanger sequencing.
    Forward Primer: hU6-F GAGGGCCTATTTCCCATGATT
    Reverse Primer: EF1a-R CACGGCGACTACTGCACTTA

Visit our viral production page for more information.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    EGFP gRNA (BRDN0000561167) was a gift from John Doench & David Root (Addgene plasmid # 80034)
  • For your References section:

    Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9. Doench JG, Fusi N, Sullender M, Hegde M, Vaimberg EW, Donovan KF, Smith I, Tothova Z, Wilen C, Orchard R, Virgin HW, Listgarten J, Root DE. Nat Biotechnol. 2016 Jan 18. doi: 10.1038/nbt.3437. 10.1038/nbt.3437 PubMed 26780180