-
PurposeExpresses humanized AsCpf1 TATV PAM variant and crRNA guide
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 89354 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC ori vector
- Backbone size w/o insert (bp) 4328
- Total vector size (bp) 8435
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCpf1 RVR variant
-
Alt nameAsCas12a, RVR variant
-
SpeciesSynthetic; Acidaminococcus sp.
-
Insert Size (bp)4107
-
MutationS542R/K548V/N552R
- Promoter CBh
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- NLS-3xHA (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AGGGATGGTTGGTTGGTGGG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This variant also recognizes TTTV and RATR PAMs (R = A or G).
Contains a U6-crRNA expression cassette (BbsI restriction sites for guide cloning).
For more information on Zhang lab CRISPR plasmids, please refer to www.addgene.org/crispr/zhang/.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAsCpf1(TATV)(BB) (pY221) was a gift from Feng Zhang (Addgene plasmid # 89354 ; http://n2t.net/addgene:89354 ; RRID:Addgene_89354) -
For your References section:
Engineered Cpf1 variants with altered PAM specificities. Gao L, Cox DBT, Yan WX, Manteiga JC, Schneider MW, Yamano T, Nishimasu H, Nureki O, Crosetto N, Zhang F. Nat Biotechnol. 2017 Jun 5. doi: 10.1038/nbt.3900. 10.1038/nbt.3900 PubMed 28581492