Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
112677-AAV2 pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (AAV2) Harvey Jan 17, 2020
134405 pBbAW4k-loxP-TT-loxP-mRFP1 W4-loxP-TT-loxP-mRFP1 Dunlop Jan 17, 2020
134404 pBbE5a-Opto-Cre-Vvd Opto-Cre-Vvd Dunlop Jan 17, 2020
128386 pLenti NLuc398-G8NCRD IRES G8NCRD-CLuc394 NLuc-3xGGGGS-Gal8-NCRD (Homo sapiens), Gal8-NCRD-3xGGGGS-CLuc398 (Homo sapiens) Duvall Jan 17, 2020
128387 pLenti NLuc398-hLGALS8 IRES hCALCOCO2-CLuc394 NLuc398-3xGGGGS-LGALS8 (Homo sapiens), CALCOCO2-3xGGGGS-CLuc394 (Homo sapiens) Duvall Jan 17, 2020
136623 pCDNA3.0_mitoSNAP NTOM20-SNAP-Tag (Synthetic) Johnsson Jan 16, 2020
132530 DYNLL1 DYNLL1 (Homo sapiens) Carter Jan 16, 2020
133386 BII-C3H Madison Jan 16, 2020
121922 pAAV-hSyn-GRAB_ACh3.0 GPCR activation based ACh sensor GRAB-ACh3.0 (Homo sapiens) Li Jan 16, 2020
121923 pAAV-hSyn-DIO-GRAB_ACh3.0 GPCR activation based ACh sensor GRAB-ACh3.0 (Homo sapiens) Li Jan 16, 2020
135267 p663-UBC-TurboID-V5-CDK13_IDG-K TurboID-V5-CDK13 (Homo sapiens) Major Jan 16, 2020
135248 p667-UBC-PKMYT1-V5_IDG-K PKMYT1-V5 (Homo sapiens) Major Jan 16, 2020
135268 p663-UBC-V5-CDK13_IDG-K V5-CDK13 (Homo sapiens) Major Jan 16, 2020
136244 pMal-EcPhr EcPhr (Other) Sancar Jan 16, 2020
136246 pcDNA4-Claspin-Flag Claspin (Homo sapiens) Sancar Jan 16, 2020
136242 pcDNA4-ZfCry4 ZfCry4 (Danio rerio) Sancar Jan 16, 2020
119281 BRCA1-plvxt BRCA1 (Homo sapiens) Massague Jan 16, 2020
119282 ID1GFP Donor Id1GFP + homology arms (Mus musculus) Massague Jan 16, 2020
119280 ID1-pLVXT Id1 (Mus musculus) Massague Jan 16, 2020
99694 pAAV-SCP1-dSa VPR mini.-2X snRP-1 Neurog2 dCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus) Church Jan 16, 2020
122880 pICE MET17 Hampton Jan 16, 2020
135252 p667-UBC-BRSK2-V5-miniTurbo_IDG-K BRSK2-V5-miniTurbo (Homo sapiens) Major Jan 15, 2020
135250 p667-UBC-TLK2-V5-TurboID_IDG-K TLK2-V5-TurboID (Homo sapiens) Major Jan 15, 2020
135273 p663-UBC-V5-BRSK2_IDG-K V5-BRSK2 (Homo sapiens) Major Jan 15, 2020
135239 p667-UBC-hcRed-V5_IDG-K hcRed-V5 (Other) Major Jan 15, 2020
135272 p663-UBC-TurboID-V5-BRSK2_IDG-K TurboID-V5-BRSK2 (Homo sapiens) Major Jan 15, 2020
135269 p663-UBC-miniTurbo-V5-BRSK1_IDG-K miniTurbo-V5-BRSK1 (Homo sapiens) Major Jan 15, 2020
135271 p663-UBC-miniTurbo-V5-BRSK2_IDG-K miniTurbo-V5-BRSK2 (Homo sapiens) Major Jan 15, 2020
136972 pGGD_RT_li_Tq2CFP_2NLS Tq2CFP (Synthetic) Theres Jan 15, 2020
136973 pGGD_RT_li_Venus Venus (Synthetic) Theres Jan 15, 2020
136971 pGGD_RT_li_Tq2CFP Tq2CFP (Synthetic) Theres Jan 15, 2020
133992 pHP038Env Envelope Glycoprotein Garg Jan 15, 2020
136967 pGGC_RT_mScarlet mScarlet (Synthetic) Theres Jan 15, 2020
136966 pGGB_RT_Venus_li Venus (Synthetic) Theres Jan 15, 2020
136965 pGGB_RT_Tq2CFP_li Tq2CFP (Synthetic) Theres Jan 15, 2020
136964 pGGB_RT_tdTomato_li tandem Tomato (Synthetic) Theres Jan 15, 2020
136981 pGGF_RT_FAST_Tq2CFP seed coat marker, replaced RFP w/ Tq2CFP. Replaced NOS terminator w/ Arabidopsis HSP18-2 terminator (Synthetic) Theres Jan 15, 2020
136978 pGGE_RT_Sa_sgRNA Sa guide RNA (Synthetic) Theres Jan 15, 2020
135258 p667-UBC-BRSK1-V5-miniTurbo_IDG-K BRSK1-V5-miniTurbo (Homo sapiens) Major Jan 15, 2020
135259 p667-UBC-BRSK1-V5_IDG-K BRSK1-V5 (Homo sapiens) Major Jan 15, 2020
135253 p667-UBC-BRSK2-V5-TurboID_IDG-K BRSK2-V5-TurboID (Homo sapiens) Major Jan 15, 2020
136979 pGGF_RT_FAST_RFP seed coat marker RFP (Synthetic) Theres Jan 15, 2020
136977 pGGD_RT_2NLS SV40 NLS (Synthetic) Theres Jan 15, 2020
136961 pGGA_RT_pLexA pLexA (Synthetic) Theres Jan 15, 2020
136980 pGGF_RT_FAST_Venus seed coat marker, replaced RFP w/ Venus. Replaced NOS terminator w/ Arabidopsis HSP18-2 terminator (Synthetic) Theres Jan 15, 2020
136968 pGGC_RT_Sa_sgRNA Sa guide RNA (Synthetic) Theres Jan 15, 2020
135301 pQE-60NA-msGFP2 msGFP2 Glick Jan 15, 2020
136287 pAVB004 - GATA23pro GATA23pro (Arabidopsis thaliana) Maizel Jan 15, 2020
133510 pAV0816 pAde6(PmeI)-p(act1)-CRIB(gic2aa2-181)-mTagBFP2-terminator(ScADH1)-bsdMX (Schizosaccharomyces pombe) Martin Jan 15, 2020
136286 pLB052 - deAct - SpVB deAct - SpvB (Other) Maizel Jan 15, 2020