|
|
152234 |
pGBW-m4134050 |
SARS-CoV-2 nsp10 (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152645 |
pGBW-m4134182 |
SARS-CoV-2 S (surface glycoprotein) (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152636 |
pGBW-m4134277 |
SARS-CoV-2 ORF3a protein (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152559 |
pGBW-m4133812 |
SARS-CoV-2 N (nucleocapsid) (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152272 |
pGBW-m4134156 |
SARS-CoV-2 nsp10 (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152201 |
pGBW-m4133408 |
SARS-CoV-2 E (envelope) (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152540 |
pGBW-m4133875 |
SARS-CoV-2 RNA-dependent RNA polymerase (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152202 |
pGBW-m4133489 |
SARS-CoV-2 nsp7 (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
152536 |
pGBW-m4133772 |
SARS-CoV-2 N (nucleocapsid) (Other)
|
Bioworks |
Jul 30, 2020 |
|
|
138133 |
pGEX6P1-EGFP-anti-rabbit-IgG(Fc)-nanobody |
EGFP-anti-rabbit-IgG(Fc)-nanobody (Other)
|
Nakayama |
Jul 30, 2020 |
|
|
138132 |
pGEX6P1-EGFP-anti-mouse-IgG(kappa)-nanobody |
EGFP-anti-mouse-IgG(kappa)-nanobody (Other)
|
Nakayama |
Jul 30, 2020 |
|
|
138131 |
pGEX6P1-mCherry-anti-rabbit-IgG(Fc)-nanobody |
mCherry-anti-rabbit-IgG(Fc)-nanobody (Other)
|
Nakayama |
Jul 30, 2020 |
|
|
138130 |
pGEX6P1-mCherry-anti-mouse-IgG(kappa)-nanobody |
mCherry-anti-mouse-IgG(kappa)-nanobody (Other)
|
Nakayama |
Jul 30, 2020 |
|
|
138129 |
pGEX6P1-mClover3-anti-rabbit-IgG(Fc)-nanobody |
mClover3-anti-rabbit-IgG(Fc)-nanobody (Other)
|
Nakayama |
Jul 30, 2020 |
|
|
138128 |
pGEX6P1-mClover3-anti-mouse-IgG(kappa)-nanobody |
mClover3-anti-mouse-IgG(kappa)-nanobody (Other)
|
Nakayama |
Jul 30, 2020 |
|
|
153291 |
pAAV-EFS-DIO-GRAB_Ado1.0 |
Adenosine sensor GRAB_Ado1.0 (Homo sapiens)
|
Li |
Jul 30, 2020 |
|
|
138417 |
CAPTURE1-1_pLVX-EF1a-BirA-P2A-FB-dCas9-IRES-zsGreen1 |
BirA (Other), dCas9 (Other)
|
Xu |
Jul 29, 2020 |
|
|
141348 |
pLX302 EGFP-V5 |
EGFP (Synthetic)
|
Janes |
Jul 29, 2020 |
|
|
138581 |
pCDH-MSCV-4xS1m-GFP-T2A-PU |
|
Mo |
Jul 29, 2020 |
|
|
140556 |
pAAV-hsyn-GRAB_rDA1m |
Red fluorescent DA sensor GRAB_rDA1m (medium affinity) (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
140553 |
pAAV-hsyn-GRAB_DA2m |
The 2nd generation DA sensor GRAB_DA2m (medium affinity) (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
140557 |
pAAV-hsyn-GRAB_rDA1h |
Red fluorescent DA sensor GRAB_rDA1h (high affinity) (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
140554 |
pAAV-hsyn-GRAB_DA2h |
The 2nd generation DA sensor GRAB_DA2h (high affinity) (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
140552 |
pAAV-hsyn-GRAB_5-HT1.0 |
5-HT sensor GRAB_5-HT1.0 (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
140555 |
pAAV-hsyn-GRAB_DA-mut |
DA-insensitive sensor GRAB_DA-mut (control sensor) (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
123353 |
pcDNA3-Cerulean3-Cerulean3-FLARE-Cameleon |
Cerulean3-Cerulean3-FLARE-Cameleon (Synthetic)
|
Zhang |
Jul 29, 2020 |
|
|
104488-PHPeB |
pGP-AAV-syn-jGCaMP7f-WPRE (AAV PHP.eB) |
|
Kim |
Jul 29, 2020 |
|
|
140558 |
pAAV-hsyn-GRAB_rDA-mut |
Red fluorescent DA-insensitive sensor GRAB_rDA-mut (control sensor) (Homo sapiens)
|
Li |
Jul 29, 2020 |
|
|
123352 |
pcDNA3-mCherry-mCherry-FLARE-Cameleon |
mCherry-mCherry-FLARE-Cameleon (Synthetic)
|
Zhang |
Jul 29, 2020 |
|
|
123338 |
pcDNA3-Dakap-Venus-cpVenus-FLARE-AKAR |
DAKAP-Venus-cpVenus-FLARE-AKAR (Saccharomyces cerevisiae)
|
Zhang |
Jul 29, 2020 |
|
|
154013 |
iOn-CAGâMCS |
MCS (Synthetic)
|
Livet |
Jul 29, 2020 |
|
|
154884 |
PB-SRT-Puro |
piggyBac SRT (Other)
|
Mitra |
Jul 29, 2020 |
|
|
154345 |
pQCi |
|
McComb |
Jul 28, 2020 |
|
|
154095 |
pSCIP-hCD69-TdTomato |
[5HA]-P2A-tdTomato-[3HA] (Synthetic), hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
|
McComb |
Jul 28, 2020 |
|
|
154094 |
pSCIP-hTRAC |
sgRNA and BAIT targeting human TRAC locus (Homo sapiens)
|
McComb |
Jul 28, 2020 |
|
|
123351 |
pcDNA3-Venus-Venus-FLARE-Cameleon |
Venus-Venus-FLARE-Cameleon (Synthetic)
|
Zhang |
Jul 28, 2020 |
|
|
123350 |
pcDNA3-Venus-cpVenus-FLARE-Cameleon |
Venus-cpVenus-FLARE-Cameleon (Synthetic)
|
Zhang |
Jul 28, 2020 |
|
|
154093 |
pQCi-hTRAC-sgRNA |
sgRNA targeting human TRAC locus (Homo sapiens)
|
McComb |
Jul 28, 2020 |
|
|
123346 |
pcDNA3-Cerulean3-Cerulean3-FLARE-CKAR |
Cerulean3-Cerulean3-FLARE-CKAR (Saccharomyces cerevisiae)
|
Zhang |
Jul 28, 2020 |
|
|
123345 |
pcDNA3-mCherry-mCherry-FLARE-CKAR |
mCherry-mCherry-FLARE-CKAR (Saccharomyces cerevisiae)
|
Zhang |
Jul 28, 2020 |
|
|
123344 |
pcDNA3-Venus-cpVenus-FLARE-CKAR(T/A) |
Venus-cpVenus-FLARE-CKAR(T/A) (Saccharomyces cerevisiae)
|
Zhang |
Jul 28, 2020 |
|
|
154091 |
pSCIP-mB2M |
sgRNA and BAIT targeting murine B2M locus (Mus musculus)
|
McComb |
Jul 28, 2020 |
|
|
123343 |
pcDNA3-Venus-cpVenus-FLARE-CKAR |
Venus-cpVenus-FLARE-CKAR (Saccharomyces cerevisiae)
|
Zhang |
Jul 28, 2020 |
|
|
154090 |
pQCi-mB2m-sgRNA |
sgRNA targeting murine B2M locus (Mus musculus)
|
McComb |
Jul 28, 2020 |
|
|
123342 |
pcDNA3-Cerulean3-Cerulean3-FLARE-EKAR-EV |
Cerulean3-Cerulean3-FLARE-EKAR-EV (Saccharomyces cerevisiae)
|
Zhang |
Jul 28, 2020 |
|
|
123341 |
pcDNA3-mCherry-mCherry-FLARE-EKAR-EV |
mCherry-mCherry-FLARE-EKAR-EV (Saccharomyces cerevisiae)
|
Zhang |
Jul 28, 2020 |
|
|
153516 |
pMSP3545-dCas9Str |
dCas9Str (Other)
|
Kline |
Jul 28, 2020 |
|
|
153517 |
pGCP123-EbpA_g1 |
pnisA-sgRNA(EbpA_g1)-dCas9 scaffold (Other)
|
Kline |
Jul 28, 2020 |
|
|
153518 |
pGCP123-GFP_g1 |
PnisA-sgRNA(GFP_g1)_dCas9 scaffold (barcoded) (Other)
|
Kline |
Jul 28, 2020 |
|
|
123339 |
pcDNA3-Venus-cpVenus-FLARE-EKAR-EV |
Venus-cpVenus-FLARE-EKAR-EV (Synthetic)
|
Zhang |
Jul 28, 2020 |
