|
|
61477 |
pDe-CAS9-D10A |
Cas9-D10A (Arabidopsis thaliana)
|
Puchta |
Sep 24, 2018 |
|
|
61476 |
pChimera |
U6-26:sgRNA (Arabidopsis thaliana)
|
Puchta |
Sep 24, 2018 |
|
|
61433 |
pDe-CAS9 |
Cas9 (Arabidopsis thaliana)
|
Puchta |
Sep 24, 2018 |
|
|
61432 |
pEn-Chimera |
AtU6-26:sgRNA (Arabidopsis thaliana)
|
Puchta |
Sep 24, 2018 |
|
|
115651 |
pJH298 |
V(D)J recombination substrate
|
Gellert |
Sep 24, 2018 |
|
|
115503 |
pOGG202 |
pL1M-F1-plac pOGG031, sfGFP pOGG037, T-pharma pOGG003 (Synthetic)
|
Poole |
Sep 24, 2018 |
|
|
115650 |
Rag2 T490A |
Rag2 (Mus musculus)
|
Gellert |
Sep 24, 2018 |
|
|
115649 |
R2Ct (1-520) |
Rag2 (1-520) (Mus musculus)
|
Gellert |
Sep 24, 2018 |
|
|
115504 |
pOGG203 |
pL1M-F2-pNeo pOGG001, mCherry EC15071, T-pharma(pOGG003 (Synthetic)
|
Poole |
Sep 24, 2018 |
|
|
115646 |
coreR1 (384-1008) |
Rag1 core (384-1008) (Mus musculus)
|
Gellert |
Sep 24, 2018 |
|
|
112008 |
pAAV-hSynapsin1-FLEx-axon-GCaMP6s-P2A-mRuby3 |
axon-GCaMP6s-P2A-mRuby3 (Synthetic)
|
Tian |
Sep 24, 2018 |
|
|
99695 |
pAAV-CMV-dSa VP64 Neurog2 |
dCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Mus musculus)
|
Church |
Sep 22, 2018 |
|
|
80591 |
TR-GFP |
GFP
|
Asokan |
Sep 22, 2018 |
|
|
115365 |
phRL TK 5BoxB sp 36 |
Renilla Luciferase (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
115360 |
pCIneo-HA |
HA (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
115359 |
pCIneo-NHA |
N peptide and HA (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
115362 |
pCIneo-HA-Ago2 |
Argonaute 2 (Homo sapiens)
|
Filipowicz |
Sep 21, 2018 |
|
|
115361 |
pCIneo-NHA-Ago2 |
Argonaute 2 (Homo sapiens)
|
Filipowicz |
Sep 21, 2018 |
|
|
115363 |
pCIneo-NHA-LacZ |
lacZ beta-D-galactosidase (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
115366 |
p CIneo-RL |
Renilla Luciferase (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
115364 |
pCIneo-RL-5BoxB |
Renilla Luciferase (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
112915 |
pLX-sgRNA-BfuAI-2k |
|
Lin |
Sep 21, 2018 |
|
|
115368 |
p CIneo-RL-Let7-3xBulgeB |
Renilla Luciferase (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
115367 |
p CIneo-RL-Let7-perf |
Renilla Luciferase (Other)
|
Filipowicz |
Sep 21, 2018 |
|
|
113633 |
pCas-CmR(+) |
Chloramphenicol resistance gene (Other)
|
Lichtarge |
Sep 21, 2018 |
|
|
112266 |
CMV-mEGFP-PKCg-C1 |
protein kinase c gamma (Mus musculus)
|
Yasuda |
Sep 21, 2018 |
|
|
115648 |
coreR2 (1-387) |
Rag2 core (1-387) (Mus musculus)
|
Gellert |
Sep 21, 2018 |
|
|
112267 |
CMV-mCh-kCAAX |
mCherry with KRas membrane targeting domain
|
Yasuda |
Sep 21, 2018 |
|
|
108685 |
CAG-mCherry |
mCherry
|
Green |
Sep 21, 2018 |
|
|
115693 |
pSTAR-mOrange2-sfGFP |
SA-mOrange2-sfGFP-SD (Synthetic)
|
Suter |
Sep 21, 2018 |
|
|
114490 |
Anti-Kirrel3, short and long [N321C/49R] |
anti-Kirrel3, short and long (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114683 |
pRC04 |
FRB-TEV-N
|
Good |
Sep 21, 2018 |
|
|
114680 |
pRC01 |
sfGFP Strands 1-9 (Synthetic)
|
Good |
Sep 21, 2018 |
|
|
114681 |
pRC02 |
sfGFP.Strand10-Haloenzyme (Synthetic)
|
Good |
Sep 21, 2018 |
|
|
115268 |
pC0073 EiCsm6 His6-TwinStrep-SUMO-BsaI |
EiCsm6 (Other)
|
Zhang |
Sep 21, 2018 |
|
|
115219 |
pC0068 PspCas13 (B12) His6-TwinStrep-SUMO-BsaI |
PspCas13 (Other)
|
Zhang |
Sep 21, 2018 |
|
|
114488 |
Anti-Dopamine D3 receptor [N331/19R] |
anti-Dopamine D3 receptor (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114487 |
Anti-Botch [N116/14R] |
anti-Botch (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114485 |
Anti-NSD3 [N348/82R] |
anti-NSD3 (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114484 |
Anti-Stonin-2 [N346/9R] |
anti-Stonin-2 (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114483 |
Anti-GluA1/GluR1 glutamate receptor [N355/1R] |
anti-GluA1/GluR1 glutamate receptor (Rattus norvegicus) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
110621 |
pBTK621 |
GFP (Synthetic)
|
Barrick |
Sep 21, 2018 |
|
|
114684 |
pRC05 |
FKBP-TEV-C
|
Good |
Sep 21, 2018 |
|
|
114481 |
Anti-QKI-5 [N195A/16R] |
anti-QKI-5 (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114479 |
Anti-Ankyrin-R [N388A/10R] |
anti-Ankyrin-R (Homo sapiens) recombinant mouse monoclonal antibody (Mus musculus)
|
Trimmer |
Sep 21, 2018 |
|
|
114682 |
pRC03 |
DHFR-sfGFP.Strand11
|
Good |
Sep 21, 2018 |
|
|
111518 |
CaM1234(D20A/D56AD93A/D129A)/pIRES2-eGFP |
calmodulin [Xenopus laevis] (Xenopus laevis)
|
Minor |
Sep 21, 2018 |
|
|
111517 |
CaM34(D93A/D129A)/pIRES2-eGFP |
calmodulin [Xenopus laevis] (Xenopus laevis)
|
Minor |
Sep 21, 2018 |
|
|
111512 |
CaM12(D20A/D56A)/pIRES2-eGFP |
calmodulin [Xenopus laevis] (Xenopus laevis)
|
Minor |
Sep 21, 2018 |
|
|
111499 |
CaM/pIRES2-eGFP |
calmodulin [Xenopus laevis] (Xenopus laevis)
|
Minor |
Sep 21, 2018 |
