We narrowed to 2,008 results for: rigi
-
Plasmid#174524PurposeExpresses human ferrochelatase (FECH) in yeastDepositorInsertFECH with yeast HEM15 promoter and terminator (FECH Synthetic, Budding Yeast, Human)
ExpressionYeastMutationLacks original mitochondrial targeting sequence (…PromoterHEM15 (yeast, 257 bp)Available SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLY70
Plasmid#130948PurposeA CRISPR activation device with the necessary genes (dxcas9 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter PrhaB), and the reporter part (PpspA-LEA3B3 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
rhaS
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterPcon, PpspA-LEA3B3, PrhaB, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Archon1-KGC-GFP-ER2
Plasmid#115890PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version). Using SV40 signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1a(1.1kb short version)Available SinceDec. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115893PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the Syn promoter, in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorHas ServiceAAV8InsertArchon1-KGC-EGFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterSynAvailable SinceNov. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLY61
Plasmid#130928PurposeA CRISPR activation device with the necessary genes (dxcas9 3.7 controlled by Ptet, pspFΔHTH::λN22plus controlled by promoter J23106), and the reporter part (PpspA-LEA1B1 with sfgfp::ASV).DepositorInsertsdxcas9 (3.7)
tetR
pspFΔHTH::λN22plus
sfgfp
UseSynthetic BiologyTagsASV tag and pspFΔHTH::λN22plusExpressionBacterialMutationMutations D10A and H840A on WT cas9 for dCas9; Sy…PromoterAnderson promoter: J23106, PpspA-LEA1B1, and PtetAvailable SinceSept. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-FLEX-rc [Archon1-KGC-GFP-ER2]
Plasmid#115891PurposeAAV-mediated expression of Archon1-KGC-GFP-ER2 under the EF1α promoter (1.1kb short version), in floxed/reversed (Cre-dependent) manner. Using bGHpA signal.DepositorInsertArchon1-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianPromoterEF1α promoter (1.1kb short version)Available SinceJuly 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 98w3 ttrSR(m13)-Bxb1_P7-bARGSer
Plasmid#232473PurposeOptimized tetrathionate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR A757
Plasmid#140829PurposeAIMTOR BRET Biosensor containing a mutated non-phosphorylable ULK1 peptide to use as a control constuct in parrallel with AIMTOR T757DepositorInsertAIMTOR A757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MB 93C1 thsS(t3)R-Bxb1_P7-bARGSer
Plasmid#232469PurposeOptimized thiosulfate sensor with recombinase switch and acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
AIMTOR T757
Plasmid#140828PurposeAIMTOR T757 contains a cytoplasmic mTOR Activity Reporter derived from hu ULK1 protein boxed between BRET-compatible entities (Ypet and Nanoluciferase) to measure mTOR activity in living cellsDepositorInsertAIMTOR T757 (ULK1 Human)
TagsNES Nuclear export signalExpressionMammalianMutationThe insert comprises only a small sequence of hum…Available SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPi Kit
Plasmid Kit#1000000136PurposePlasmids for performing CRISPR/Cas9 mediated gene and genome editing in Pichia pastoris.DepositorApplicationGenome EditingVector TypeYeast ExpressionEditing TypeCRISPRAvailable SinceAug. 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
GoldenPiCS Kit
Plasmid Kit#1000000133PurposeA flexible modular system for advanced strain engineering in Pichia pastoris to accomplish pathway expression, protein production, or other DNA integration applications.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeYeast ExpressionCloning TypeGolden GateAvailable SinceFeb. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Antibody#251722-rAbPurposeAnti-Slit-2 (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse Slit-2. Not expected to cross-react with other Slits.DepositorArticleRecommended ApplicationsImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceMarch 13, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#219609-rAbPurposeAnti-Neurexin-3a (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for mouse NRXN3a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistryReactivityMouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237797-rAbPurposeAnti-Neurexin-1a (Human) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN1a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistry and ImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237802-rAbPurposeAnti-Neurexin-1a (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN1a. Weak cross-reactivity to other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237808-rAbPurposeAnti-Neurexin-2a (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN2a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#237806-rAbPurposeAnti-Neurexin-2a (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains. Shows strong binding to human and mouse NRXN2a, and weak cross-reactivity with other NRXNsDepositorArticleRecommended ApplicationsImmunocytochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits
-
Antibody#244068-rAbPurposeAnti-Neurexin-2a (Mouse) chimeric recombinant antibody with fused human variable and rabbit constant domains; specific for human and mouse NRXN2a. Does not cross-react with other NRXNs.DepositorArticleRecommended ApplicationsImmunocytochemistry and ImmunohistochemistryReactivityHuman and MouseSource SpeciesRabbitIsotypeIgGTrial SizeNot available to purchaseAvailable SinceFeb. 19, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits