We narrowed to 7,152 results for: CAD;
-
Plasmid#203319PurposeOverexpression of BCAM-MCAM chimerasDepositorInserthBCAM/hMUC18
TagsFlag (DYKDDDK)ExpressionMammalianMutationIgG V1-C1 of hMuc18 fused to Ig like C2-C3 of hBC…Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
hBCAM-B2
Plasmid#203314PurposeOverexpression of BCAM-MCAM chimerasDepositorInserthMUC18/hBCAM
TagsFlag (DYKDDDK)ExpressionMammalianMutationIgG V1-V2 of hBCAM fused to Ig like C1-C3 of hMU…Available SinceJuly 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp2 H237A-EGFP
Plasmid#201425PurposeBacterial protein expression of Dcp2 H237ADepositorInsertDcp2 (DCP2 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationH237APromotertacAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dhh1 25-425-EGFP
Plasmid#201430PurposeBacterial protein expression of Dhh1 25-425DepositorInsertDhh1 (DHH1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 25-425 onlyPromotertacAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp2 301-970-EGFP
Plasmid#201429PurposeBacterial protein expression of Dcp2 301-970DepositorInsertDcp2 (DCP2 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 301-970 onlyPromotertacAvailable SinceJune 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dhh1 426-506-EGFP
Plasmid#201431PurposeBacterial protein expression of Dhh1 426-506DepositorInsertDhh1 (DHH1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 426-506 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp1 D82-129-EGFP
Plasmid#201426PurposeBacterial protein expression of Dcp1 del82-129DepositorInsertDcp1 (DCP1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationdeletion of aa 82-129PromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp1 H206A-EGFP
Plasmid#201424PurposeBacterial protein expression of Dcp1 H206ADepositorInsertDcp1 (DCP1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationH206APromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp1 82-129-EGFP
Plasmid#201427PurposeBacterial protein expression of Dcp1 82-129DepositorInsertDcp1 (DCP1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 82-129 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pat1 1-240-EGFP
Plasmid#201435PurposeBacterial protein expression of Pat1 1-240DepositorInsertPat1 (PAT1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 1-240 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Edc3 67-282-EGFP
Plasmid#201433PurposeBacterial protein expression of Edc3 67-282DepositorInsertEdc3 (EDC3 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 67-282 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pat1 241-422-EGFP
Plasmid#201436PurposeBacterial protein expression of Pat1 241-422DepositorInsertPat1 (PAT1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 241-422 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp1 H198A-EGFP
Plasmid#201423PurposeBacterial protein expression of Dcp1 H198ADepositorInsertDcp1 (DCP1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationH198APromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp1 H43A-EGFP
Plasmid#201422PurposeBacterial protein expression of Dcp1 H43ADepositorInsertDcp1 (DCP1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationH43APromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp1 H40A-EGFP
Plasmid#201421PurposeBacterial protein expression of Dcp1 H40ADepositorInsertDcp1 (DCP1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationH40APromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Dcp2 1-300-EGFP
Plasmid#201428PurposeBacterial protein expression of Dcp2 1-300DepositorInsertDcp2 (DCP2 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 1-300 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Pat1 423-796-EGFP
Plasmid#201437PurposeBacterial protein expression of Pat1 423-796DepositorInsertPat1 (PAT1 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 423-796 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
Edc3 283-551-EGFP
Plasmid#201434PurposeBacterial protein expression of Edc3 283-551DepositorInsertEdc3 (EDC3 Budding Yeast)
TagsEGFP, TEV, 6xHis and MBP, TEVExpressionBacterialMutationaa 283-551 onlyPromotertacAvailable SinceMay 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-luciferase
Plasmid#198590PurposeGateway Entry CloneDepositorInsertluciferase
UseGateway entry vectorMutationNone (wildtype)Available SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR223-SM
Plasmid#195814PurposeGateway Entry Clone of Epstein-Barr virus SMDepositorInsertSM
UseGateway entry vectorAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
p5’UTR-ORF1
Plasmid#190566PurposeHolding vector containing the contiguous 5’UTR and ORF1 regions of human L1 (L1.3) to facilitate subcloning of ORF1 mutants into the full-length L1 reporter pRTC2-puro (Cook et al., 2015).DepositorInsertContiguous regions of the human L1 (L1.3) 5’UTR and ORF1
UseFor dna propagation onlyExpressionBacterialPromoterN/AAvailable SinceMay 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-Tsks/1D4
Plasmid#199623PurposeExpression vector of mouse TSKS (variant X6). 1D4 tag at C-terminus.DepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG1.1-HA/Ppp1cc2
Plasmid#199626PurposeExpression vector of mouse PPP1CC2. HA tag at N-terminus.DepositorAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pC1300_pUB10_pcoCASphi_E9t_MCS_version1
Plasmid#197937PurposeT-DNA binary vector to express pcoCasphi driven by UBQ10 gene promoter, with SV40 NLS at the N-terminal and nucleoplasmin NLS at the C-terminal.DepositorInsertpcoCasphi-2
UseCRISPRExpressionPlantPromoterpUBQ10Available SinceMarch 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr-CM
Plasmid#188585PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler Catalytic mutant
TagsFLAG-MycExpressionInsectMutationdeleted first ATG; D435A [GAT=>GCC]; E435A [GA…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[N1-383]
Plasmid#188586PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler N-terminal domain
TagsFLAG-MycExpressionInsectMutationdeleted first ATGAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAFMW-Nbr[C399-625]
Plasmid#188587PurposeFlag-tagged Nibbler variants expression in Drosophila S2 cellsDepositorInsertNibbler C-terminal domain
TagsFLAG-MycExpressionInsectAvailable SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRB121
Plasmid#181945PurposeaTc-inducible expression of dimerized mNeonGreen (mNG-mNG)DepositorInsertmNeonGreen-mNeonGreen; tetR (AX04_RS23485 Synthetic)
ExpressionBacterialMutationSee Depositor Comments BelowPromotermNG-mNG-PLtetO-1; tetR-J23106Available SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG1
Plasmid#188967PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtggaaaacaatgcgaccgactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT-GFP-rG2
Plasmid#188968PurposeIPTG inducible GFP with sgRNADepositorInsertsGFP
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only