We narrowed to 7,250 results for: puc
-
Plasmid#53063PurposeTranscription of guide RNA (gRNA) in rice cellsDepositorInsertOsU3 promoter + gRNA scaffold
UseCRISPR; Plant expressionTagsExpressionMutationPromoterrice U3Available sinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-dsRed-shscramble
Plasmid#71384PurposeExpresses dsRed and scramble shRNA under the control of the CMV promoter in eukaryotic cellsDepositorInsertCMV promoter-dsRed-mir30-shscramble
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterCMV enhancer/promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMO746
Plasmid#117480Purposeupp in an artificial operon with npt from pMO9071 and AmpR-pUC ori from pCR4/TOPO, Pnpt-npt-upp;, KanRDepositorInserturacil phosphoribosyltransferase
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAsCpf1(TYCV)(BB) (pY211)
Plasmid#89352PurposeExpresses humanized AsCpf1 TYCV PAM variant and crRNA guideDepositorInsertCpf1, RR variant
UseCRISPRTagsNLS and NLS-3xHAExpressionMammalianMutationS542R/K607RPromoterCBhAvailable sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAsCpf1(TATV)(BB) (pY221)
Plasmid#89354PurposeExpresses humanized AsCpf1 TATV PAM variant and crRNA guideDepositorInsertCpf1 RVR variant
UseCRISPRTagsNLS and NLS-3xHAExpressionMammalianMutationS542R/K548V/N552RPromoterCBhAvailable sinceJuly 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-dsRed-shvgat
Plasmid#71385PurposeExpresses dsRed and shRNA against vgat under the control of the CMV promoter in eukaryotic cellsDepositorInsertCMV promoter-dsRed-mir30-shvgat
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterCMV enhancer/promoterAvailable sinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAd388-shLuc
Plasmid#83275PurposeshRNA targeting luciferaceDepositorInsertshRNA to Luciferase
UseRetroviralTagsExpressionMutationPromoterpUC oriAvailable sinceDec. 2, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
KG#797
Plasmid#110916PurposeExpresses the active zone - enriched protein Sentryn-GFP in a subset of cholinergic ventral nerve cord motor neuronsDepositorInsertsunc-129 promoter
STRN-1 (Sentryn)-GFP
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
UseTagsGFP (contains 3 artificial introns)ExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#920
Plasmid#110937PurposeExpresses INS-22-Emerald in the cholinergic motor neuron DA9 for imaging Dense Core Vesicles in a single neuron in a living animalDepositorInsertsmig-13 promoter
INS-22-Emerald
unc-54 3' control region with 1 artificial intron just upstream and 1 artificial intron in control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
KG#493
Plasmid#110932PurposeExpresses proteins in C. elegans cholinergic neurons in head, ventral nerve cord, and tailDepositorInsertsunc-17 promoter
unc-54 3' control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
KG#94
Plasmid#110931PurposeExpresses proteins in C. elegans cholinergic neurons in head, ventral nerve cord, and tailDepositorInsertsunc-17 promoter
unc-54 3' control region
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)
Plasmid#42335PurposeA human codon-optimized SpCas9 nickase and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9 (D10A) nickase
UseCRISPRTagsHAExpressionMammalianMutationD10A nickase-converting mutationPromoterAvailable sinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBR_attB(bxb)_lox
Plasmid#183762PurposeBxb1-specific donor plasmid for the cloning of payloads <20 kbDepositorTypeEmpty backboneUseCre/Lox and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
CLYBL-Bxb1-LP-v2-TC
Plasmid#194327PurposeCLYBL targeting construct with the Bxb1 landing pad version 2 cassette.DepositorInsertloxP-EBFP2-attP-BleoR-lox251
UseCre/Lox and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Bxb1-LP-v2-TC
Plasmid#194326PurposeAAVS1 targeting construct with the Bxb1 landing pad version 2 cassette.DepositorInsertloxP-EBFP2-attP-BleoR-lox251
UseCre/Lox and Synthetic BiologyTagsExpressionMammalianMutationPromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFBOS_CreIRESpuro
Plasmid#183812PurposeExpresses Cre recombinase and puromycin N-acetyltransferase driven by the mammalian EF1a promoterDepositorInsertCre recombinase
UseSynthetic BiologyTagsNLSExpressionMammalianMutationPromoterAvailable sinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTn7CdrA-gfp(ASV)C
Plasmid#111617PurposeFluorescence-based gauging of the level of the nucleotide secondary messenger cyclic di-GMP in Pseudomonas aeruginosa and related species.DepositorInsertPcdrA-RBSII-gfp(ASV)-T0-T1
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTn7CdrA-gfpC
Plasmid#111616PurposeFluorescence-based gauging of the level of the nucleotide secondary messenger cyclic di-GMP in Pseudomonas aeruginosa and related species.DepositorInsertPcdrA-RBSII-gfp(Mut3)-T0-T1
UseTagsExpressionBacterialMutationPromoterAvailable sinceJune 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU3-gRNA
Plasmid#53063PurposeTranscription of guide RNA (gRNA) in rice cellsDepositorInsertOsU3 promoter + gRNA scaffold
UseCRISPR; Plant expressionTagsExpressionMutationPromoterrice U3Available sinceAug. 21, 2014AvailabilityAcademic Institutions and Nonprofits only