We narrowed to 15,630 results for: sgrna
-
Plasmid#80036Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-LMNB1
Plasmid#207770PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the N-terminus of LMNB1 for knock-in.DepositorInsertsgRNA Targeting N-terminus of LMNB1 (LMNB1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre stuffer v4
Plasmid#158032Purposelenti-viral construct with Cre recombinase and U6 driven sgRNA casette with modified tracrRNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI). NO Cas9DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJZC43
Plasmid#66565PurposesgRNA + 2XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 2XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_NPM1_G6
Plasmid#178091PurposeExpresses the NPM1 G6 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with NPM1_mNeonGreen_Donor to tag NPM1 with mNeonGreen. pX330-like plasmid.DepositorInsertNPM1 G6 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-CANX
Plasmid#227279PurposeExpresses SpCas9 and a sgRNA targeting the C-terminus of CANX for knock-in.DepositorAvailable SinceNov. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-VIM
Plasmid#227301PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of VIM for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKRG3-mU6-PUb-hSpCas9-pAc
Plasmid#162163PurposeExpresses hSpCas9-T2A-pAc (Ae. aegypti PUb promoter) with cloning site for sgRNAs (Ae. aegypti U6 promoter); puromycin selectableDepositorInsertshSpCas9
sgRNA
UseCRISPRTagsT2A-pAcExpressionInsectPromoterAe. aegypti PUb and Ae. aegypti U6Available SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.SFFV.tRFP
Plasmid#57826PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-tRFP
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUC57-Amp_CRISPIE donor B5
Plasmid#172846PurposeCRISPIE donor B5 (Zhong et al, eLife 2021), CDS of VCL exon21-mEGFP, translational phase (0-stop), excised by ACTB i4 sgRNA or DRS-1 sgRNA (with SpCas9).DepositorInsertCRISPIE designer exon (phase 0-stop) encoding the CDS of VCL exon 21 fused to mEGFP
UseCRISPRAvailable SinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-Cre stuffer v4
Plasmid#158033PurposeLentiviral construct with Cas9, Cre recombinase and U6 driven sgRNA cassette with modified tracr RNA (20bp sgRNA can be cloned by digesting the stuffer 1.8kb with BsmBI)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-MAPRE1
Plasmid#207793PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of MAPRE1 for knock-in.DepositorInsertsgRNA Targeting C-terminus of MAPRE1 (MAPRE1 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-CEP135
Plasmid#227286PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of CEP135 for knock-in.DepositorInsertsgRNA Targeting N-terminus of CEP135 (CEP135 Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-pegSERPINA1-U6-Nicking-PE2-N
Plasmid#164907PurposeExpress a pegRNA targeting SERPINA1, and a nicking sgRNA and the N-terminal split-intein fragment of PE2DepositorInsertpegSERPINA1, Nicking sgRNA, PE2-N
UseAAVAvailable SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000561167)
Plasmid#80034Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_1
Plasmid#138324PurposeExpress guide RNA 2 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
BPK2101
Plasmid#65770PurposeBacterial expression plasmid for S. aureus Cas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSaCas9-NLS-3xFLAG-T7-BsaIcassette-Sa-sgRNADepositorInsertmammalian codon-optimized SaCas9, and SaCas9 gRNA
UseCRISPRTagsNLS-3xFlagExpressionBacterialPromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgMyc_2
Plasmid#138346PurposeExpress guide RNA 1 for mouse MycDepositorAvailable SinceFeb. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-PermE
Plasmid#209446Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning siteDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from ermE* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
MSP712
Plasmid#65768PurposeBacterial expression plasmid for Sp-dCas9 & sgRNA (need to clone in spacer into BsaI sites): T7-humanSpdCas9(D10A/H840A)-T7-BsaIcassette-Sp-sgRNADepositorInsertmammalian codon-optimized Streptococcus pyogenes dCas9 (D10A/H840A)-NLS-3XFlag, and SpCas9 gRNA
UseCRISPRTags3x FLAG and NLSExpressionBacterialMutationD10A and H840A mutations in Cas9PromoterT7 (x2)Available SinceJune 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-CLTC
Plasmid#227312PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of CLTC for knock-in.DepositorAvailable SinceNov. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS887_pTetR-P2A-BFPnls/sgAlpha
Plasmid#108651PurposeAlpha satellite repeats targeting Spy sgRNA under U6 promoterDepositorInsertsAlpha satellite repeats targeting sgRNA
TetR-P2A-BFP
UseCRISPR and LentiviralTagsNoExpressionMammalianPromoterU6 and hPGKAvailable SinceMay 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB[U6-3 wex2 PUb-DsRed]
Plasmid#169010PurposeFor germline transformation. Expresses white exon 2 sgRNA and DsRed marker in all cells.DepositorInsertwhite ex2 sgRNA
UsePiggybacExpressionInsectPromoterDrosophila melanogaster U6:3Available SinceApril 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
EGFP gRNA (BRDN0000562805)
Plasmid#80035Purpose3rd generation lentiviral gRNA plasmid targeting EGFPDepositorInsertEGFP
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-deSpCas9
Plasmid#92114PurposeExpression plasmid for human codon-optimized dead/inactive increased fidelity eSpCas9 (1.1) (without U6-sgRNA coding sequence)DepositorInsertdead/inactive eSpCas9 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, H840A, K848A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330-PITCh-PEX3
Plasmid#227303PurposeExpresses SpCas9, the PITCh gRNA, and a sgRNA targeting the C-terminus of PEX3 for knock-in.DepositorAvailable SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-RAB7A
Plasmid#227297PurposeExpresses SpCas9 and a sgRNA targeting the N-terminus of RAB7A for knock-in.DepositorInsertsgRNA Targeting N-terminus of RAB7A (RAB7A Human)
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgAmotl2 v3
Plasmid#158602Purposelenti-viral construct with Cas9, Cre recombinbase and U6 driven sgRNA against mouse Amotl2DepositorInsertAmotl2 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pL-CRISPR.SFFV.PAC
Plasmid#57829PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA, Puromycin resistance, SFFV Promoter drivenDepositorInsertsSpCas9
Sp sgRNA scaffold
SFFV
P2A-PAC
UseCRISPR and LentiviralTagsFLAGAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
px330-GAPDH
Plasmid#136940PurposeNHEJ assay. sgRNA/Cas9 plasmid. Target DSB at human GAPDH; induce CD4+ deletion rearrangement by pairing w/ px330-CD4DepositorAvailable SinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
B52 + SPRTN sgSTOP
Plasmid#100709PurposeB52 plasmid expressing SPRTN sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting SPRTN (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGPT2_5
Plasmid#163455Purposelentiviral vector expressing Cas9 and an sgRNA targeting GPT2DepositorInsertsgRNA 5 targeting GPT2 (GPT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX330-Flag-dSpCas9-HF1
Plasmid#92115PurposeExpression plasmid for human codon-optimized dead/inactive high-fidelity SpCas9-HF1 (without U6-sgRNA coding sequence)DepositorInsertdead/inactive SpCas9-HF1 with FLAG tag
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationD10A, N497A, R661A, Q695A, H840A, Q926APromoterCbhAvailable SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLC-EGFP-RIP1
Plasmid#75163PurposeLentiCRISPR-EGFP with sgRNA targeting human RIPk1DepositorInsertRIPK1 sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC42
Plasmid#66564PurposesgRNA + 1XPP7 with PCP-VP64 effector for mammalian cells, marked by mCherryDepositorInsertssgRNA + 1XPP7
PCP-VP64 IRES mCherry
ExpressionMammalianPromoterCMV and U6Available SinceJuly 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMETAP1_2
Plasmid#163463Purposelentiviral vector expressing Cas9 and an sgRNA targeting METAP1DepositorInsertsgRNA 2 targeting METAP1 (METAP1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
HeFSpCas9
Plasmid#92355PurposeExpression plasmid for human codon-optimized increased fidelity HeFSpCas9 (without U6-sgRNA coding sequence)DepositorInsert3xFLAG-NLS-Streptococcus pyogenes Highly enhanced Fidelity Cas9-NLS
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationN497A, R661A, Q695A, K848A, Q926A, K1003A, R1060APromoterCbhAvailable SinceOct. 31, 2017AvailabilityAcademic Institutions and Nonprofits only