We narrowed to 2,323 results for: SE
-
Plasmid#64635Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertAR (transcript variant 1, splice isoform) (AR Human)
UseLentiviralMutationsplice isoform*PromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
beta-catenin (S33A, S37A, T41A, S45A)-pcw107-V5
Plasmid#64613Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
p53 (dominant negative R175H mutant)-pcw107-V5
Plasmid#64638Purpose3rd generation lentiviral transfer plasmid. When used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBK-CMV-mpx
Plasmid#191826Purposempx probe generation for in situDepositorAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
YAP1 (S6A) - V5 in pLX304
Plasmid#42562DepositorInsertYAP1 (YAP1 Human)
UseLentiviralTagsV5ExpressionMammalianMutationS61A, S109A, S127A, S128A, S131A, S163A, S164A, S…PromoterCMVAvailable SinceMarch 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
fabp10a:lox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR; cryaa:mCherry
Plasmid#230043PurposePartial ablation and subsequent lineage tracing of regenerating hepatocytes in zebrafish.DepositorInsertlox2272-loxp-nls-mTagBFP2-stop-lox2272-H2B-mGL-stop-loxp-mCherry-NTR
UseCre/Lox; Zebrafish expressionPromoterfabp10aAvailable SinceFeb. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
BCL-XL-pcw107-V5
Plasmid#64631Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
myr-FLAG-AKT1-pcw107
Plasmid#64606Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Caspase-3 (C163A)-pcw107-V5
Plasmid#64633Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertCASP3 (transcript variant beta) (CASP3 Human)
UseLentiviralTagsV5MutationC163APromoterPGKAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
beta-catenin (S33A, S37A, T41A, S45A)-pcw107
Plasmid#64612Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
IKKalpha (S176E,S180E)-pcw107-V5
Plasmid#64608Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
p-Tet-O-RUNX1T1-Puro
Plasmid#221666PurposeExpresses RUNX1T1 in mammalian cellsDepositorInsertRUNX1T1 (RUNX1T1 Human)
UseLentiviralAvailable SinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
LMPd Amt OXCT1
Plasmid#209407PurposeRetroviral vector with Ametrine marker for expressing shRNA with an "UltramiR" microRNA scaffoldDepositorInsertOxct1 shRNA (Oxct1 Mouse)
UseRetroviralAvailable SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
AR-V7-pcw107-V5
Plasmid#64636Purposewhen used to produce lentivirus, express physiological levels of insertDepositorInsertAR (transcript variant 1, splice isoform) (AR Human)
UseLentiviralTagsV5Mutationsplice isoform *PromoterPGKAvailable SinceDec. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBabe_puro_DEST_Flag_MDS1
Plasmid#45258DepositorAvailable SinceJune 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
pB-Tet-On-HTR6-RhoA sensor
Plasmid#189614PurposeTet-On cilia-targeted RhoA sensor (Xlone piggybac back-bone); HTR6-fused with a sGFP-mScarlet-I based sensorDepositorAvailable SinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
Hras (G12V)-pcw107
Plasmid#64603Purposewhen used to produce lentivirus, express physiological levels of insertDepositorAvailable SinceMay 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-PPO-Venus
Plasmid#139504PurposeAAV vector for Cre-dependent expression of Venus-tagged parapinopsin driven by the CAG promoter. Used for photoswitchable control of inhibitory GPCR signaling cascades.DepositorHas ServiceAAV5 and AAV9Insertparapinopsin
UseAAVTagsVenus tag following 3x Ala linkerExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DEST (w118-1) eGFP
Plasmid#107505PurposeExpresses eGFP, puromycin resistantDepositorInserteGFP
UseLentiviralExpressionMammalianPromoterCMVAvailable SinceNov. 7, 2018AvailabilityAcademic Institutions and Nonprofits only