We narrowed to 13,573 results for: cas9 genes
-
Plasmid#133793PurposeU6 promoter sgRNA entry vector used for all CjeCas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V2-TGAA linker sgRNA architecture from Kim et al. Nature Communications 2017DepositorInsertCjeCas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV2-TGAA linker sgRNA architecture from Kim et al.…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-Ppsba2-dCas9-SpR
Plasmid#73220PurposeContains dCas9 from S. pyogenes under constitutive promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
UseTagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPpsbA2Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
lenti SYN-SVI-dCas9-VPR
Plasmid#164575PurposeExpresses an intron-containing dCas9-VPR fusion driven by human SYN promoterDepositorInsertFLAG-dCas9-VPR containing an SV40 intron
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterAvailable sinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCA23-sgRNA vector-U6-sgTS2 (SpCas9)
Plasmid#199454PurposeU6-driven sgRNA targeting TS2 sequence (GGAGCTTACTGAGACTCTTC)DepositorInsertTS2 sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available sinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR-L3-Csy4-FokI-dCas9-EGFP-L2
Plasmid#141047PurposeMutisite Gateway mediated vector constructionDepositorInsertCsy4-2A-FokI-dCas9-2A-EGFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St1Cas9-sgRNA (KAC14)
Plasmid#133791PurposeU6 promoter sgRNA entry vector used for all St1Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to V1 sgRNA architecture from Carter et al. biorxiv 2018DepositorInsertSt1Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationV1 sgRNA architecture from Carter et al. biorxiv …PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-U6-BsmBI_cassette-St3Cas9-sgRNA (KAC27)
Plasmid#133792PurposeU6 promoter sgRNA entry vector used for all St3Cas9 sgRNAs (clone spacer oligos into BsmBI cassette) - similar to sgRNA architecture from Muller et al. Molecular Therapy 2015DepositorInsertSt3Cas9 sgRNA entry vector
UseTagsExpressionMammalianMutationsgRNA architecture from Muller et al. Molecular T…PromoterU6Available sinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-dCas9-p300 Core (C1204R)
Plasmid#61361Purposeencodes S. pyogenes dCas9 with c-terminal fusion of human p300 HAT core (aa 1048-1664; mutation C1204R) driven by CMV promoterDepositorInsertS.pyogenes dCas9 with c-terminal human p300 Core effector fusion (aa 1048-1664 of human p300) (EP300 S. pyogenes, Human, Synthetic)
UseCRISPR and Synthetic BiologyTagsFlag, HA, and SV40 NLSExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9; C1204R mutation i…PromoterCMVAvailable sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
p300 core-dCas9-CBP core
Plasmid#179559Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human p300 core (aa 1048-1664) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorInsertgRNA targeting human Rab7A (RAB7A Human)
UseTagsExpressionMammalianMutationPromoterU6Available sinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-mCherry - BAKgRNA1- BAKgRNA2
Plasmid#167295PurposePlasmid encoding for 2 gRNAs targeting the human BAK gene and a CMV driven nuclease Cas9 followed by self-cleaving mCherryDepositorInsertBAK (BAK1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9nucl-T2A-EGFP - BAXgRNA1- BAXgRNA2
Plasmid#167296PurposePlasmid encoding for 2 gRNAs targeting the human BAX gene and a CMV driven nuclease Cas9 followed by self-cleaving EGFPDepositorInsertBAX (BAX Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pHDE-35S-Cas9-mCherry-UBQ
Plasmid#78932PurposeFor CRISPR/Cas9 mediated gene editing in Arabidopsis; provides a visual screen for Cas9-free plants. Enable production of two gRNAsDepositorTypeEmpty backboneUseCRISPRTagsExpressionPlantMutationPromoterAvailable sinceJuly 12, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-idCas9-KRAB-Hygro donor
Plasmid#199621PurposeDonor vector for genomic targeting of a Tetracycline-inducible dCas9-KRAB cassette to the human AAVS1/PPP1R12C locusDepositorInsertAAVS1-idCas9-KRAB-Hygro
UseTagsExpressionMutationPromoterAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-p300 core
Plasmid#179553Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
peSpCas9(1.1)-2×sgRNA (IFT88, donor)
Plasmid#80769PurposeExpresses eSpCas9(1.1) and two sgRNAs. The first gRNA targets human IFT88 and the second gRNA targets a pDonor-tBFP-NLS-Neo (Universal).DepositorInsertIFT88 gRNA#1 (IFT88 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-TBK1-gRNA (PX459)
Plasmid#221550PurposeExpresses Cas9 and gRNA for disruption of TBK1 gene in human cellsDepositorInsertgRNA targeting human TBK1 (TBK1 Human)
UseTagsExpressionMammalianMutationPromoteru6Available sinceJuly 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
GCN5 core-dCas9-CBP core
Plasmid#179555Purposeencodes S. pyogenes dCas9 with n-terminal fusion of human GCN5 core (aa 473-676) and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceFeb. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
CBP core-dCas9-CBP core
Plasmid#179560Purposeencodes S. pyogenes dCas9 with both n-terminal and c-terminal fusion of human CBP core (aa 1084-1701) driven by EF-1alpha promoterDepositorInsertUseLentiviralTagsFlag TagExpressionMammalianMutationD10A; H840A in S.pyogenes Cas9PromoterEF-1alphaAvailable sinceJune 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-BRD4-HaloTag-Guide-hspCas9
Plasmid#228576PurposeExpression of Halo-tagged human BRD4 gRNA; CRISPR-mediated gene insertionDepositorInsertBRD4 gRNA (BRD4 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only