We narrowed to 4,082 results for: Gaa
-
Plasmid#200208PurposegRNA for HSF2 KODepositorAvailable SinceMay 17, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pX458-MAFB-sg
Plasmid#194720Purposepx458 with guide RNA that target hMAFBDepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Npm1-R
Plasmid#122331PurposeExpresses sgRNA targeting mouse Npm1 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Npm1
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Dhx15-R
Plasmid#122335PurposeExpresses sgRNA targeting mouse Dhx15 and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Dhx15
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
px335-sgRNA-EF(Cas9n)-Dnmt3l-L
Plasmid#122321PurposeExpresses sgRNA targeting mouse Dnmt3l and Cas9 nickase in mammalian cellsDepositorInsertsgRNA for mouse Dnmt3l
ExpressionMammalianAvailable SinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
pAN-PBAD-sgRNA-A5T
Plasmid#62264Purposeexpression of A5T sgRNA from the arabinose-inducible promoterDepositorInsertA5T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A5NT
Plasmid#62263Purposeexpression of A5NT sgRNA from the arabinose-inducible promoterDepositorInsertA5NT sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAN-PBAD-sgRNA-A4T
Plasmid#62262Purposeexpression of A4T sgRNA from the arabinose-inducible promoterDepositorInsertA4T sgRNA
UseCRISPRExpressionBacterialPromoterpBADAvailable SinceApril 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
(pRZ75) AAV: U6-gRNA(cs1)-EF1a-Cre-P2A-mCherry
Plasmid#254581PurposeAAV backbone expressing Cre recombinase and mCherry from the EF1a promoter and one U6-driven sgRNA with SapI spacer and capture sequence in scaffoldDepositorInsertCre
UseAAVAvailable SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
-
pT2/shCol1a1/Scarlet-Seq1.1
Plasmid#201401PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pT2/Col1a1/GFP4_Seq 1.1
Plasmid#201400PurposeKnockdown of Collagen Type 1 alpha 1. Construct has inverted repeats to be used in Sleeping Beauty transposon system.DepositorInsertCOL1A1
ExpressionMammalianAvailable SinceMay 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS1
Plasmid#174301PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #1 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDGO186N-KS2
Plasmid#174302PurposeReplicating plasmid with sgRNA cassette containing a killing spacer #2 targeting the wild type polC gene.DepositorInsertspacer expression cassette
ExpressionBacterialAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJF144_SECGFP_sg2
Plasmid#163865PurposesgRNA targeting GFP in C. elegans. Backbone: pJJR50.DepositorInsertsgRNA targeting GFP
UseCRISPRExpressionWormPromoterR07E5.16 (U6)Available SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTBL322 GC
Plasmid#126950PurposeTo target a protospacer with GC at the cut site.DepositorInsertspacer against human genome with GC at cut site
ExpressionMammalianPromoterhuman U6Available SinceMay 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti_DualsgRNA_TIMM23_Puro_T2A_BFP2
Plasmid#236731PurposeDual sgRNA targeting TIMM23 expressing BFP with Puromycin selectionDepositorInsertTIMM23 (TIMM23 Human)
UseLentiviralAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only