We narrowed to 223 results for: Fga
-
Plasmid#196696PurposeExpresses APP695 with an HA tag an N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only
-
APP-bio-His
Plasmid#51643PurposeExpresses full-length Amyloid beta A4 protein precursor ectodomain in mammalian cells. C-terminal rat Cd4d3+4 tag, biotinylation sequence and His tag.DepositorInsertAPP (APP Human)
TagsHis tag, enzymatic biotinylation sequence, and ra…ExpressionMammalianPromoterCMVAvailable SinceFeb. 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Human ABeta-attR5
Plasmid#160436PurposeEntry vector for cloning human Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human)
ExpressionBacterialAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
APP_pcDNA6.2/EmGFP-Bsd
Plasmid#176954PurposeMammalian expression vector encoding APP and EmGFP-BsdDepositorAvailable SinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APP-mGFP
Plasmid#196704PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmCherry and mEGFPExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCherry-APPP1-mGFP
Plasmid#196705PurposeAs mCherry-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmCherry and mEGFPExpressionMammalianMutationLys to Val substitution at position 612Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APPP1-mGFP
Plasmid#196695PurposeAs mBFP-APP-mGFP, but with substitution at position 612 that prevents alpha-secretase activityDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmEGFP and mtagBFP2ExpressionMammalianMutationLys to Val substitution at position 612PromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
mBFP-APP-mGFP
Plasmid#196694PurposeExpresses APP695 with two fluorescent proteins at the ends to follow processing in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsmEGFP and mtagBFP2ExpressionMammalianPromoterCMVAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
AP-APP
Plasmid#196706PurposeExpresses APP695 with a biotin Acceptor Peptide tag at N-terminal for single molecule tracking and other measusers in mammalian cellsDepositorInsertAmyloid Precursor Protein 695 isoform (APP Human)
TagsAP, Avitag and HAExpressionMammalianAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-Tol2-PA2-CMV-AB-mCh
Plasmid#160435PurposeExpresses human Amyloid Beta-mCherry in ZebrafishDepositorInsertHuman Amyloid Beta peptide (1-42) (APP Human, Zebrafish)
UseZebrafish expressionTagsmCherryPromoterCMVAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorTags13xMyc, Flag, and HAExpressionMammalianPromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pUCIDT-attL1-Worm ABeta-attR5
Plasmid#160437PurposeEntry vector for cloning nematode-codon-optimized Amyloid Beta(1-42) using 2-fragment gateway recombinationDepositorInsertHomo sapiens amyloid beta precursor protein (APP Human, Nematode)
TagsCleavage signalExpressionBacterialMutationCodon-optimized for expression in C. elegansAvailable SinceOct. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-AICD-IRES-hrGFP
Plasmid#107548Purposehigh transduction efficiency AAV-mediated synapsin promoter-dependent expression of AICD (last 50 amino acids of APP) and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_LUP1
Plasmid#103857PurposeHeterologous, cobalt-inducible expression of SQE1 and LUP1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertlupeol synthase 1 (LUP1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NLS-IRES-hrGFP
Plasmid#107543PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Localisation Signal (NLS: CCAAAAAAGAAGAGAAAGGTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1
Plasmid#103860PurposeHeterologous, cobalt-inducible expression of SQE1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertsqualene epoxidase 1 (XF1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted gene is codon optimized. 2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJan. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPBbleo-TGFa-EREG-ScNeo
Plasmid#209915PurposeTo express the chimeric protein of TGFα and EREG, which a recombinant TGFα protein fused extracellularly to the mScarlet and a recombinant Epiregulin protein fused intracellularly to the mNeonGreenDepositorTagsGGGSGGGS linker, HA tag, mNeonGreen, and mScarlet…ExpressionMammalianAvailable SinceNov. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_THAS1
Plasmid#103859PurposeHeterologous, cobalt-inducible expression of SQE1 and THAS1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertthalianol synthase 1 (THAS1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized. 2nd amino aci…PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceJuly 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVZ_PcoaT_SQE1_MRN1
Plasmid#103858PurposeHeterologous, cobalt-inducible expression of SQE1 and MRN1 from A. thaliana in Synechocystis sp. PCC6803DepositorInsertmarneral synthase 1 (MRN1 Mustard Weed)
UseSynthetic BiologyExpressionBacterialMutationinserted genes are codon optimized2nd amino acid …PromoterPcoaT (from Synechocystis sp. PCC 6803)Available SinceFeb. 23, 2018AvailabilityAcademic Institutions and Nonprofits only