We narrowed to 8,815 results for: tre promoter
-
Plasmid#98099PurposeZebrafish aBb crystallin 2kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 2 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio alpha Bb-crystallin 2 kb fragment (-2092/-1)Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA™5/FRT/CMV_promoter-Cas9-E2A-mRFP
Plasmid#164131PurposeExpresses SpCas9 and mRFP in mammalian cells (an insertion vector to generate Cas9-knockin cell lines)DepositorInsertSpCas9 (cas9 Synthetic)
UseCRISPR and Synthetic BiologyTagsExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Danio alpha Bb-crystallin 1kb promoter/AcGFP
Plasmid#98098PurposeaBb-crystallin promoter fragment in GFP plasmid to assess activity in larval embryosDepositorInsertAlpha Bb-crystallin promoter 1 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio aBb-crystallin 1 kb fragment (-1074/-1)Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish aBb crystallin 5kb promoter/AcGFP
Plasmid#98101PurposeZebrafish aBb crystallin 5kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 5 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio alpha Bb-crystallin 5 kb promoter fragment …Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
Zebrafish aBb crystallin 4kb promoter/AcGFP
Plasmid#98100PurposeZebrafish aBb crystallin 4kb promoter segment driving GFP expressionDepositorInsertAlpha Bb-crystallin promoter 4 kb fragment, Danio rerio (cryabb Zebrafish)
UseGfp expressingTagsGFPExpressionMutationPromoterDanio alpha Bb-crystallin 4 kb promoter fragment …Available sinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
hum alpha ENAC promoter a25-a23
Plasmid#83427Purposepromoter reporter construct to test 5' flanking sequencesDepositorInserthuman aENaC gene 5' flanking seq + 55 nt of the 5' UTR for exon 1A (SCNN1A Human)
UseLuciferaseTagsLuciferaseExpressionMutationPromoteralpha ENACAvailable sinceApril 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti-SCGB3A2 promoter-EGFP-EF1a-TagRFP
Plasmid#204821PurposeLentiviral vector for human SCGB3A2 promoter-driven expression of EGFPDepositorInsertAn upstream region including human SCGB3A2 promoter
UseLentiviralTagsExpressionMammalianMutationPromoterSCGB3A2 promoterAvailable sinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHB9-MCS-IRES-EGFP (mHb9 promoter) [TJ#103]
Plasmid#16283DepositorInsertHB9 promoter (Mnx1 Mouse)
UseMouse TargetingTagsIRES-EGFPExpressionMammalianMutationPromoterAvailable sinceFeb. 4, 2009AvailabilityAcademic Institutions and Nonprofits only -
Mut.Blimp1pGL3 (Mutant human Blimp1 promoter in pGL3-basic)
Plasmid#40341DepositorInsertBlimp1 promoter (mutated) (PRDM1 Human)
UseLuciferaseTagsLuciferaseExpressionMammalianMutationTwo AP-1 sites at -1813 and -1647 replaced with B…PromoterBlimp1Available sinceOct. 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Rat SARE-Arc Min Promoter-Flag Arc-Arc Genomic 3'UTR
Plasmid#233056PurposeTo express Flag-tagged Rat Arc from a Rat SARE-Arc minimal promoter. The Arc gene contains the Rat Arc native Genomic 3'UTR containing two intronsDepositorInsertRat Arc (Arc Rat)
UseAAVTagsFlagExpressionMutationPromoterAvailable sinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-splitTVA-EGFP-tTA (AAV1)
Viral Prep#100798-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-syn-FLEX-splitTVA-EGFP-tTA (#100798). In addition to the viral particles, you will also receive purified pAAV-syn-FLEX-splitTVA-EGFP-tTA plasmid DNA. Helper virus for monosynaptic tracing with rabies virus; to be coinjected with pAAV-TREtight-mTagBFP2-B19G (Addgene#100799). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFP (Cre-dependent)Available sinceDec. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
Chromoprotein kit 2.0
Plasmid Kit#1000000198PurposeChromoprotein plasmid kit that contain two new chromoprotein genes that are less toxic to E. coli so that the plasmids are more stable during growth.DepositorAvailable sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUpstream2Lox
Plasmid#164573PurposeIntegration of 2 LoxN sites in the genome of P. bergheiDepositorInsertsUseCre/LoxTagsExpressionMutationPromoterBidirectional PbEF1alpha promoter (PBANKA_1133300…Available sinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chromoprotein kit 1.0
Plasmid Kit#1000000174PurposeA synthetic biology collection of plasmids for expression of chromoproteins in bacteria, which can be used as an educational resource.DepositorAvailable sinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-CCRB
Plasmid#236772PurposeA piggybac-based cloning vector containing TRE3G promoter followed by cloning site and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorTypeEmpty backboneUsePiggybacTagsExpressionMammalianMutationPromoterTRE3G promoter, CAG promoterAvailable sinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-TP53-CCRB
Plasmid#236773PurposeA piggybac-based cloning vector containing TRE3G promoter-driven full-length TP53 and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorInsertTP53 (TP53 Human)
UsePiggybacTagsExpressionMammalianMutationPromoterTRE3G promoter and TRE3G promoter, CAG promoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-TRE3G-dN40-TP53-CCRB
Plasmid#236774PurposeA piggybac-based cloning vector containing TRE3G promoter-driven short-form of TP53 and CAG promoter-driven nuclear-localized Clover-P2A-rtTA-IRES-BSD.DepositorInsertTP53 (TP53 Human)
UsePiggybacTagsExpressionMammalianMutationdeleted amino acids 1-40PromoterTRE3G promoter and TRE3G promoter, CAG promoterAvailable sinceMay 29, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHR_TRE3G_mCherry_WPRE_PGK_tagBFP
Plasmid#231952PurposeLentiviral vector for inducible expression of the red fluorescent protein mCherry (TRE3G promoter) and constitutive expression of the blue fluorescent protein tagBFP (PGK promoter)DepositorInsertmCherry
UseLentiviralTagsExpressionMutationPromoterAvailable sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-dSaCas9-KRAB-gRNA-TRE-blast
Plasmid#201151PurposeLentiviral expression of S. aureus dead Cas9 (dCas9/dSaCas9/SadCas9) fused to the KRAB domain as well as a gRNA targeting the tight TRE promoter and the blasticidin resistance gene.DepositorInsertsSadCas9-KRAB
gRNA-TRE
UseCRISPR and LentiviralTagsHAExpressionMutationgRNA sequence: ATCAGTGATAGAGAACGTATGPromoterAvailable sinceJuly 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-hChR2-H134R-tdTomato (AAV Retrograde)
Viral Prep#28017-AAVrgPurposeReady-to-use AAV Retrograde particles produced from AAV-CAG-hChR2-H134R-tdTomato (#28017). In addition to the viral particles, you will also receive purified AAV-CAG-hChR2-H134R-tdTomato plasmid DNA. Humanized channelrhodopsin H134R mutant fused to tdTomato, under the control of the CAG promoter. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomatoAvailable sinceJune 20, 2017AvailabilityAcademic Institutions and Nonprofits only