We narrowed to 9,022 results for: aav
-
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVExpressionMammalianPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CKAR3
Plasmid#238413PurposeAAV construct with CKAR3 expression under a human synapsin promotor and WPRE3 translation enhancer.DepositorInsertCKAR3 (PKC sensor)
UseAAVExpressionMammalianAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits onlyCited by -
GfaABC1D-cyto-iATPSnFR1.0
Plasmid#102553Purposeexpresses cytoplasmic ATP sensor in astrocytesDepositorInsertiATPSnFR1.0
UseAAVAvailable sinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa-VPR mini.-2X snRP1
Plasmid#99688PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains with 34 nt dual snRP1 poly adenylation signalDepositorPublicationInsertdCas9
UseAAVTagsVPR miniMutationdead Cas9Available sinceOct. 24, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pOTTC1328 - pAAV EF1a HA-hM3D(Gq)
Plasmid#89149PurposeAn AAV packaging plasmid that expresses HA-tagged hM3D(Gq) excitatory DREADD from the EF1a promoter.DepositorInserthM3D(Gq)
UseAAVTagsHAExpressionMammalianPromoterEF1aAvailable sinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBK1290-AAV-dSaCas9
Plasmid#223139PurposeAAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianAvailable sinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-DIO-CFL-SN
Plasmid#181740PurposeAAV vector for expressing CFL-SNDepositorInsertCFL-SN
UseAAVExpressionMammalianPromoterEF1alphaAvailable sinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiLAMP5e3_ChR2_mCherry
Plasmid#213915PurposeAAV construct expressing mCherry-tagged channelrhodopsin-2 driven by Lamp5 interneuron-targeting enhancer. Alias: pAAV_WDL0003_ChR2_mCherryDepositorHas serviceAAV1 and AAV PHP.eBInsertChannelrhodopsin 2-mCherry
UseAAVAvailable sinceJuly 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-ProC3-Cre/mCherry
Plasmid#126006PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCre-2A-mCherry
UseAAVPromoterProC3Available sinceSept. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-UbC-mNeonGreen
Plasmid#124102PurposeExpression of the fluorescent protein mNeonGreen in mammalian cellsDepositorInsertmNeonGreen
UseAAVExpressionMammalianMutationCodon usage was optimized for Homo SapiensPromoterUbCAvailable sinceApril 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-CREB
Plasmid#68550PurposeAAV expression of CREBDepositorInsertCREB
UseAAVTagsEGFPExpressionMammalianPromoterCMVAvailable sinceAug. 18, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-CMV-FLEX-SaCas9-U6-sgNts
Plasmid#159909PurposeMutagenesis of NtsDepositorInsertNts (Nts Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV_LP1B_St1Cas9_LMD-9_SpA_U6_sgRNA
Plasmid#110624PurposeA single vector AAV-Cas9 system containing a liver-specific promoter with Cas9 from Streptococcus thermophilus CRISPR1 (St1Cas9 LMD-9) and its U6-driven sgRNADepositorInsertsSt1Cas9 LMD-9
sgRNA for St1Cas9
UseAAV, CRISPR, and Mouse TargetingTagsSV40 NLSExpressionMammalianPromoterLP1B and hU6Available sinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC_RR_VP1_r1c3
Plasmid#65724PurposeRescued infectious variant from pAAV2_RaPID library; mCherry insertion in place of the deleted amino acid sequence 453-GTTTQSRDepositorInsertmCherry
UseAAVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV GFAP jGCaMP7b
Plasmid#171118PurposeAstrocyte AAV-mediated expression of bright ultrasensitive protein calcium sensor under the GFAP promoterDepositorInsertjGCaMP7b
UseAAVTags6 His Tag, T7 Tag, and Xpress TagExpressionMammalianPromoterGFAPAvailable sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-SYN_mEGFP-CREB
Plasmid#137006PurposeAAV backbone, mEGFP-CREB donor for G-CREBDepositorAvailable sinceMay 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pscAAV.CAG-EGFP-SV40pA-T7-T3-BC(p1-14)
Plasmid#231346PurposeSelf complementary AAV genome with components for tracking self-complementary AAV genomes via AAV-Zombie. Also expresses EGFP from CAG promoter.DepositorInsertT7/T3-BC(p1-14)
UseAAVAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-FLEx(FRT)-G
Plasmid#67828PurposeFlp-dependent expression of rabies glycoprotein to mediate trans-synaptic spread of modifed rabies virus in cellsDepositorInsertrabies glycoprotein
UseAAVExpressionMammalianAvailable sinceSept. 16, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pTCAV-FLEx(loxP)-FlpO
Plasmid#67829PurposeCre-dependent expression of FlpO from CAV2 virusDepositorInsertFlpO
ExpressionMammalianAvailable sinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAP2
Plasmid#73211Purposeexpress Assembly-activating protein (AAP) of adeno-associated virus serotype 2 (AAV2)DepositorInsertAAP2
UseAAVExpressionMammalianPromoterCMVAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only