We narrowed to 14,184 results for: GAN
-
Plasmid#118022PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only
-
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCAG-SpyTag-Flag-Lbr-V5-mCherry
Plasmid#235094PurposeLbr mCherry fusion protein without MCP domainDepositorAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR003-sgTP53-1
Plasmid#118019PurposeConstitutive expression of sgRNA targeting human TP53DepositorAvailable SinceOct. 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPB-AMBRA1-3xFLAG
Plasmid#174159PurposePiggyBac vector to stably express 3xFLAG-tagged AMBRA1DepositorAvailable SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
Lenti-RNF2-tevopreQ1-epegRNA+5G>T_EF1a-puroR
Plasmid#207355PurposeLentiviral transfer plasmid encoding hU6-driven expression of a RNF2 engineered prime editing guide (epegRNA) and EF1a-driven puromycin resistance gene.DepositorInsertRNF2 + 5G>T tevopreq1-prime editing guide RNA (epegRNA)
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPL001-BBTK
Plasmid#184751PurposeBig-IN positive control payload encoding EF1a-driven GFP-T2A-BSD. Harbors a backbone counterselectable TK cassette.DepositorInsertpEF1a-eGFP-T2A-BSD-bGHpA
UseCre/Lox, Mouse Targeting, and Synthetic Biology ;…ExpressionMammalianPromoterEF1aAvailable SinceJan. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
iGFP-gamma-actin
Plasmid#231554PurposeMammalian expression of human gamma actin fused intramolecularly to monomeric superfolder GFPDepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
DNA-CARzeta-GFP
Plasmid#89344Purpose2nd generation lentiviral vector which expresses DNA-CAR receptor fused to GFPDepositorAvailable SinceJune 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV x EF1a_EKAREN4-ires-blast
Plasmid#167829PurposeOptimized EKAREV FRET biosensor sensor for ERKDepositorInsertEKAREN4
UseLentiviralTagsnls localization motifExpressionMammalianMutationK424P, K426WPromoterEF1aAvailable SinceApril 20, 2021AvailabilityAcademic Institutions and Nonprofits only