We narrowed to 7,774 results for: ALP
-
Plasmid#173764PurposeBacterial coexpression of CBP TAZ1 with CITED2/Hif1a activation domain constructsDepositorTagsHis6GB1 and thrombinExpressionBacterialMutationfusion of CITED2 and Hif1aPromoterT7Available SinceFeb. 1, 2022AvailabilityAcademic Institutions and Nonprofits only
-
TRUPATH Triple Gai2
Plasmid#196049PurposeEncodes a G alpha subunit (GNAl2) with RLuc8, a G gamma subunit (GNG8) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga11
Plasmid#196059PurposeEncodes a G alpha subunit (GNA11) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Ga15
Plasmid#196060PurposeEncodes a G alpha subunit (GNA15) with RLuc8, a G gamma subunit (GNG13) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gagust
Plasmid#196054PurposeEncodes a G alpha subunit (GNAT3) with RLuc8, a G gamma subunit (GNG1) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2975
Plasmid#144451PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF2510
Plasmid#144032PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEMS1499
Plasmid#29247PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle28 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1498
Plasmid#29246PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle27 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEMS1500
Plasmid#29248PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle29 (CCL27 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceOct. 20, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
PB513B-1/TRE-hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBPγ-EF1α-Puro
Plasmid#199550PurposePiggyBac-based transposon vector plasmid which encodes the expression units of liver-enriched transcription factor genes (hHNF1α-hHNF3β-hCEBPα-hCEBPβ-hCEBP-γ) under control of the TRE/PCMVmin promoterDepositorUsePiggybac transposon vectorExpressionMammalianPromoterTRE+CMVmin promoterAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luc-ZsGreen
Plasmid#39196DepositorInsertsFirefly Luciferase Luc2P
ZsGreen
UseLentiviralExpressionMammalianPromoterEF1-alpha and EF1-alphaAvailable SinceOct. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pHIV-Luciferase
Plasmid#21375Purposeself-inactivating 3rd generation lentiviral plasmid for co-expression of your gene of interest and LuciferaseDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 19, 2009AvailabilityAcademic Institutions and Nonprofits only -
Gaq-LSS-SGFP2
Plasmid#112951PurposeGalphaq tagged with LSS-SGFP2DepositorInsertGalphaq
TagsLSS-SGFP2ExpressionMammalianPromoterCMVAvailable SinceSept. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-C1-p85beta
Plasmid#1408DepositorAvailable SinceJune 22, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKI-v2
Plasmid#45066PurposeExpression of PKI (PKA inhibitor)DepositorInsertcAMP-dependent protein kinase inhibitor alpha
ExpressionMammalianPromoterRSVAvailable SinceJuly 31, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGEX-4T3-p85beta
Plasmid#1406DepositorAvailable SinceNov. 14, 2005AvailabilityAcademic Institutions and Nonprofits only -
pRSV-PKImut-v2
Plasmid#45067PurposeExpression of intactive PKI (PKA inhibitor) mutantDepositorInsertcAMP-dependent protein kinase inhibitor alpha
ExpressionMammalianMutationchanged Arg 20 & 21 to GlycinesPromoterRSVAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHCA/GAL4(848).ER
Plasmid#108215PurposeYeast expression vector for fusion of Gal4 AA 1-848 to hormone binding domain of estrogen receptor aDepositorInsertGal4-ERalpha HBD
ExpressionYeastMutationERalpha HBD has G400V mutationPromoterADH0Available SinceApril 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only