We narrowed to 7,026 results for: SIM
-
Plasmid#13805DepositorAvailable SinceFeb. 22, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pTD103luxI_sfGFP -R
Plasmid#48887PurposePositive feedback plasmid from oscillator without luxRDepositorInsertsfGFP and luxI
UseSynthetic BiologyTagsssrA tag (AANDENYALAA)ExpressionBacterialPromoterpLuxAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNCS-CyRFP1
Plasmid#84546PurposeBacterial expression of CyRFP1DepositorInsertCyRFP1
TagsHisExpressionBacterialAvailable SinceOct. 31, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCHNFI-C2
Plasmid#31403DepositorAvailable SinceSept. 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
pET28a SV40 ST full length
Plasmid#132636Purposeexpresses SV40 ST full length in E. coliDepositorInsertSV40 small t antigen
ExpressionBacterialAvailable SinceNov. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET11a-dH2B
Plasmid#105501PurposeExpression of Drosophila histone H2B. An additional Ile codon was inserted after the initiating Met codon to enhance the protein expression levelDepositorInsertdH2B
Available SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pzk384-pmax-PUFc-FseI-RESCUE-SalI-NES
Plasmid#196831PurposeExpress PUFc-RESCUE-SDepositorInsertPUFc-RESCUE
ExpressionMammalianAvailable SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET28a-HA-CPDSalI
Plasmid#38254DepositorTypeEmpty backboneTags6xHis, HA, and Vibrio cholerae MARTX toxin cystei…ExpressionBacterialPromoterT7Available SinceAug. 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTD103aiiA(Cm) -R
Plasmid#48888PurposeNegative feedback plasmid from oscillator without luxRDepositorInsertaiiA
UseSynthetic BiologyTagsssrA tag (AANDENYALAA)ExpressionBacterialPromoterpLuxAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET22b-HA-CPDSalI
Plasmid#38253DepositorTypeEmpty backboneTags6xHis, HA, and Vibrio cholerae MARTX toxin cystei…ExpressionBacterialPromoterT7Available SinceJuly 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
gS gag LV
Plasmid#12327DepositorInsertgag/pol
UseLentiviralExpressionMammalianMutationThe CypA binding region of the WT gag was replace…Available SinceAug. 17, 2006AvailabilityAcademic Institutions and Nonprofits only -
pZSm45 sodA
Plasmid#48890PurposeLux-regulated expression of sodA enzymeDepositorInsertsodA LuxR
UseSynthetic BiologyTagsssrA tag (AANDENYALAA)ExpressionBacterialPromoterpLuxAvailable SinceFeb. 6, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJT103
Plasmid#25087DepositorInsertPompC-lacZ
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
RCAS(A) cTbx5 (CT#634)
Plasmid#13963DepositorInsertTbx5 (TBX5 Chicken)
UseRetroviral; Avian expressionAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only -
pMODloxZeo3DAmp
Plasmid#27182DepositorInsertlox-EM7p-Zeo-lox cassette flanked by Tn5 outer element
UseIn vitro transposionAvailable SinceOct. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
pVB004
Plasmid#127188PurposeTunable NOT gate without RiboJ insulatorDepositorInsertTunable NOT gate and Reporter without RiboJ Insulator
ExpressionBacterialAvailable SinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
p201N 1509
Plasmid#55768PurposeContains soybean miRNA miR1509 recognition sequence (CAACCTTGATTTCCTTGATTAA) to produce siRNAs from 3' target sequences and induce RNA silencingDepositorTypeEmpty backboneUseRNAiPromoterGmUbiAvailable SinceSept. 8, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET-C5
Plasmid#246823PurposeExpression plasmid for C5 protein of E. coli RNase PDepositorInsertC5 protein of E. coli RNase P
TagsHistidine tagExpressionBacterialPromoterT7 promoterAvailable SinceDec. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUC-M1
Plasmid#246824PurposePlasmid for in vitro expression of M1 RNA of E. coli RNase PDepositorInsertM1 RNA of E. coli RNase P
ExpressionBacterialPromoterT7 promoterAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYihI
Plasmid#233088PurposeExpression of GST-YihI (wildtype sequence)DepositorInsertYihI
TagsGSTExpressionBacterialAvailable SinceMay 7, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits