We narrowed to 8,883 results for: aav
-
Plasmid#196418PurposeCre-dependent AAV expression of GFP preferentially in astrocytes; astrocyte selectivity generated with 4x6T miRNA targeting cassetteDepositorInsertGFP
UseAAV and Cre/Lox; Astrocyte-selectiveExpressionMammalianPromoterCAGAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_NES-his-CaMPARI2-F391W-L398V
Plasmid#119723PurposeAAV vector expressing CaMPARI2_F391W-L398V (Kd = 174nM), a photoconvertible fluorescent protein-based calcium integrator, in neuronsDepositorInsertsCaMPARI2
CaMPARI2
UseAAVTagsNES-hisExpressionMammalianMutationF391W, L398VPromoterhSyn1Available SinceJan. 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
Pzac2.1 U6-control sgRNA1, 2, 3_gfaABC1D mcherry SV40
Plasmid#179120PurposeExpresses control sgRNAs under the U6 promoter and mcherry protein specifically in astrocytesDepositorInsertcontrol sgRNA
UseAAVPromoterU6Available SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGfap-R-CaMP1.07-WPRE-SV40
Plasmid#164140PurposeAAV vector to express the red Ca2+ indicator R-CaMP1.07 in astrocytes.DepositorInsertR-CaMP1.07
UseAAVPromoterhGFAPAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-TVA66T-EGFP
Plasmid#64091PurposeExpresses TVA66T-EGFP under the CAG promotorDepositorInsertTVA66T-EGFP
UseAAV and Cre/LoxTagsEGFPExpressionMammalianMutationGlutamic acid 66 to ThreoninePromoterCAGAvailable SinceApril 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAAV-minBG-SYFP2
Plasmid#236723PurposeSYFP2-taggedDepositorInsertSYFP2
UseAAVAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-DEST(f)
Plasmid#190226PurposeGateway destination vector, empty AAV vector backboneDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-WPRE
Plasmid#130992PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagseYFPPromoterhSynAvailable SinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-FLEX-ArchT-GFP
Plasmid#58851PurposeAAV-mediated expression of ArchT-GFP under the EF1a promoter, in floxed/reversed (Cre-dependent) mannerDepositorInsertArchT-GFP
UseAAV and Cre/LoxTagsGFPExpressionMammalianPromoterEF1aAvailable SinceAug. 14, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ConVERGD-TVA(mChr)-W3SL
Plasmid#218754PurposeProvides AND intersectional (Cre+Flp) expression of TVA-mCherryDepositorInsertTVA-mCherry
UseAAVTagsmCherryPromoterhSynAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-DIO-HA-HCARD-P2A-mCitrine
Plasmid#228902PurposeFor AAV packaging and Cre-dependent expression of a peripherally restricted DREADDDepositorHas ServiceAAV8Inserthydroxycarboxylic acid receptor 2 (Hcar2 Mouse)
UseAAV and Synthetic BiologyTagsHA and P2A mCitrineExpressionMammalianMutationR108KPromoterChicken Beta ActinAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-eBFP2-NLS-pA
Plasmid#183800PurposeAAV vector to express nuclear localized eBFP2 from CMV promoterDepositorInserteBFP2-NLS
UseAAVTagsNLSAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-DIO-eGFP-2A-TetanusToxin (Cre-OFF)
Plasmid#166611PurposeEncodes Cre-inactivated GFP-2A-Tetanus toxin light chain under control of the TREDepositorInsertEGFP-2A-Tetanus Toxin
UseAAVPromotertetracycline response elementAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
132_pAAV-ProB2-CatCh-GFP-WPRE
Plasmid#125922PurposeTargeting expression to neuronal and glial cell types in mice, non-human primates, and human retinaDepositorInsertCatCh-GFP
UseAAVPromoterProB2Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS hOPM
Plasmid#112498PurposeHomologous recombination vector for dox-inducible overexpression of OTX2, PAX6, and MITF in AAVS locus.DepositorAvailable SinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV.CAG.GLPLight1
Plasmid#187467PurposeExpresses GLPLight1 in mammalian cellsDepositorInsertGLPLight1
UseAAVTagsFlag tagPromoterCAGAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-Bi-gePSI-pCMV-AcGFP
Plasmid#131008PurposeExpresses both the gePSI-α-chain and the gePSI-β-chain under control of the inducible bi-directional TRE3G promoter. Expresses constitutively AcGFP under control of a CMV promoter.DepositorInsertsgePSI-β-chain
gePSI-α-chain
AcGFP1
UseAAVTagsmurine ornithine decarboxylase - degron (ODC36)ExpressionMammalianPromoterpCMV and pTRE3G-BiAvailable SinceDec. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOTTC385 - pAAV CMV-IE IRES EGFP
Plasmid#102936PurposeAn AAV vector that expresses IRES EGFP under the CMV-IE promoterDepositorInsertEGFP
UseAAVExpressionMammalianPromoterCMV-IEAvailable SinceSept. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn GFP-Fxr1
Plasmid#112732PurposeAAV plasmid that expresses GFP-Fxr1 fusion protein under hSYN promoterDepositorAvailable SinceMay 14, 2019AvailabilityAcademic Institutions and Nonprofits only