We narrowed to 15,169 results for: invs
-
Plasmid#153537PurposeAAV-mediated expression of Jaws-GFP-ER2 under the EF1α promoter (1.1kb short version).DepositorInsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterEF1α1.1Available SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpp1-is2
Plasmid#58248PurposeExpression vector producing isoform 2 derived mouse osteopontin (EGFP tagged)DepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpp1-is3
Plasmid#58247PurposeExpression vector producing isoform 3 derived mouse osteopontin (EGFP tagged)DepositorAvailable SinceMarch 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2]
Plasmid#84445PurposeAAV-mediated expression of Jaws-KGC-GFP-ER2 under the CAG promoter, in floxed/reversed (Cre-dependent) manner.DepositorHas ServiceAAV Retrograde, AAV1, and AAV5InsertJaws-KGC-GFP-ER2
UseAAVTagsER2, GFP, and KGCExpressionMammalianMutationK200R W214FPromoterCAGAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43 M337V
Plasmid#162618PurposeAllows for transcription of mCerulean fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mCerulean 156-239-GGGS-TDP-43
Plasmid#162617PurposeAllows for transcription of mCerulean fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-GGGS-TDP43 M337V
Plasmid#162612PurposeAllows for transcription of mVenus fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-I152L-GGGS-TDP-43
Plasmid#162614PurposeAllows for transcription of improved mVenus I152L fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BACH1t_RFP
Plasmid#199214PurposeBACH1 C-terminus truncated isoform - BACH1t expression plasmid with a RFP reporter on the backbone.DepositorAvailable SinceJune 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α1.1-Jaws-KGC-tdTomato-ER2
Plasmid#153538PurposeAAV-mediated expression of Jaws-tdTomato-ER2 under the EF1α promoter (1.1kb short version).DepositorInsertJaws-KGC-tdTomato-ER2
UseAAVTagsER2, KGC, and tdTomatoExpressionMammalianMutationK200R W214FPromoterEF1α1.1Available SinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX304-GFP-IQSEC1 v2-E620K GEF dead mutant
Plasmid#162020PurposeExpression of GEF dead IQSEC1 mutantDepositorAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
CD59-CD4d3+4-bio
Plasmid#73117PurposeEXPRESs plasmid for human erythrocyte surface proteins encoding CD59 with rat CD4d3+4-bioDepositorTagsbiotinylation peptide and ratCD4d3+4ExpressionMammalianPromoterCMVAvailable SinceMarch 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:IL2_SigP:NLuc
Plasmid#197266PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human IL2 locus (exon 3). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertInterleukin-2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-I152L-GGGS-TDP43 M337V
Plasmid#162615PurposeAllows for transcription of improved mVenus I152L fluorophore half fused to mutant TDP-43-M337V for injection into zebrafish embryos for BiFC assaysDepositorAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCS2plus-mVenus1-155-GGGS-TDP-43
Plasmid#162611PurposeAllows for transcription of mVenus fluorophore half fused to TDP-43 for injection into zebrafish embryos for BiFC assaysDepositorInsertTARDBP (TARDBP Human)
ExpressionMammalianAvailable SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pINSPECT:NEAT1-v2_SigP:NLuc
Plasmid#197268PurposeDonor plasmid for CRISPR/Cas9-mediated insertion of INSPECT into human NEAT1 locus (long isoform only). Encodes for intronic IRES-driven SigP:NLuc. Plasmid contains FRT-site flanked PuroR-TK cassette.DepositorInsertNEAT1-v2 homology arms
UseCRISPR, Luciferase, Synthetic Biology, and Unspec…ExpressionMammalianAvailable SinceApril 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEXSISERS_FLuc_loxP-PuroR
Plasmid#177866PurposeCloning Backbone for Firefly-luciferase-based EXSISERS containing loxP-sites flanked PuroR cassetteDepositorInsertFLuc-based EXSISERS
UseCRISPR, Cre/Lox, Luciferase, Synthetic Biology, a…TagsFLAGExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 39Vm13 ttrSR(m13)-bARGSer
Plasmid#232472PurposeOptimized tetrathionate sensor with acoustic reporter genes (bARGSer)DepositorInsertsttrS
ttrR
PttrB185-269
bARGSer
AxeTxe
ExpressionBacterialMutationthe gene Ser39006_001280 was deleted from the clu…PromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits