We narrowed to 10,667 results for: plasmids 101
-
Plasmid#154772Purposeplasmid with 4xhybrid PylT cassette (Mx1201 G1 PylT hybrid mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, hybrid PylT with A41AA an…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xhyb PylT A41AA C55A sfGFP 102TAA 150TAG
Plasmid#154777Purposeplasmid with 4xhybrid PylT cassette (mutant A41AA C55A) and dual suppression reporter sfGFP 102TAA 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation102TAA 150TAG in GFP reporter, hybrid PylT with …PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
B52 + TIMELESS sgSTOP
Plasmid#100713PurposeB52 plasmid expressing TIMELESS sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting TIMELESS (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PARP4 sgSTOP
Plasmid#100711PurposeB52 plasmid expressing PARP4 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PARP4 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSN67
Plasmid#100124Purposeexpresses putative KLF4 DBD with a 6xHis tagDepositorInsertmCherry-P2A-putative KLF4 DBD with a 6xHis tag (KLF4 Human)
UseLentiviralExpressionMammalianMutationInsert corresponds to the DBD of KLF4Available SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
B52 + PIK3R1 sgSTOP
Plasmid#100714PurposeB52 plasmid expressing PI3KR1 sgSTOP (cloned in BbsI site) and containing an empty sgRNA-expression cassette (use BsmBI for cloning)DepositorInsertsgSTOP targeting PIK3R1 (cloned using BbsI)
UseCRISPRExpressionMammalianPromoterU6 promotersAvailable SinceSept. 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Salsa-BC260-P3F8
Plasmid#203101PurposeExpression of barcoded reporter plasmid for PRESTO-Salsa; EGFP/BC260DepositorInsertEGFP/BC260
ExpressionMammalianPromoterTet Response Element (TRE)Available SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-cytoFLARE1.0/1.1-TF
Plasmid#234516PurposeTranscriptional reporter for detecting calcium transients in neuronal cultures (transcription factor)DepositorInsertERT2-MK2-hLOV-TEVcs-FLAG-tTA
UseAAVExpressionMammalianAvailable SinceApril 30, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.hSynapsin.TagBFP-P2A-Pre-SPHERE-SF-iGluSnFR
Plasmid#187101PurposeGlutamate sensor for localization to membrane contatctDepositorArticleInsertPre-SPHERE-SF-iGluSnFR
UseAAVTagsTagBFP-P2AExpressionMammalianPromoterhSynAvailable SinceOct. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pRS316-OsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
Plasmid#198417PurposeExpresses both OsTIR1F74A and mAID-Nb(VHHGFP4) under the control of ADH1 promoter in budding yeastDepositorInsertOsTIR1F74A-T2A-mAID-Nb (VHHGFP4)
ExpressionYeastPromoterADH1 promoterAvailable SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
T7-AglC-His6
Plasmid#89726PurposeExpresses AglC from M. voltae with an N-terminal T7 tag and a C-terminal His6 tag. Plasmid has codons optimized for E. coli expression.DepositorInsertAglC
TagsHis6 and T7ExpressionBacterialAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
T7-AglK-His
Plasmid#89714PurposeExpresses AglK from M. voltae with an N-terminal T7 tag and a C-terminal His6 tag. Plasmid has codons optimized for E. coli expression.DepositorInsertAglK
TagsHis6 and T7ExpressionBacterialAvailable SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSLC25A13-APEX2
Plasmid#228198Purposeplasmid encoding human SLC25A13 with an APEX protein tagDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCm No carrier NikJC199U
Plasmid#174361PurposeExpression plasmid with a TEV removable C-term 8xHis Tag and Chloramphenicol resistance. NikJ C199U cloned in the cloning site.DepositorInsertnikJ, nikkomycin biosynthesis protein P1 [Streptomyces tendae]
Tags8xHis and TEVExpressionBacterialMutationC199UPromoterT7Available SinceDec. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRRG370-GS1
Plasmid#99101PurposedsRNA and riboprobe synthesis for Schmidtea mediterranea GS-1DepositorInsertGS-1 in situ probe
UseT/a cloning vector for dsrna generation and the g…Available SinceOct. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGL2 (basic) 3xARE Lux
Plasmid#14934DepositorInsert3xARE
UseLuciferaseTagsluciferaseExpressionMammalianAvailable SinceMay 17, 2007AvailabilityAcademic Institutions and Nonprofits only -
AAV-F in pAR-9
Plasmid#166921PurposeAAV rep/cap plasmid. Capsid is mouse brain tropic AAV-FDepositorInsertREP/CAP
UseAAVAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
plRL19
Plasmid#163634PurposeL5 Integrase delivery plasmid to allow integration of L5 attP only plasmids (e.g. plRL61, ID #163633).DepositorInsertL5 Integrase
ExpressionBacterialPromoterMycobacterial Optimized Promoter (MOP) and Tet-OnAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
plRL58
Plasmid#166886PurposeOptimized M. tuberculosis CRISPRi plasmid; contains an L5 attP region (no L5 Integrase) that allows for integration when co-transformed with an L5 Integrase delivery plasmid (e.g. plRL19, ID #163634)DepositorTypeEmpty backboneUseCRISPRExpressionBacterialPromoterTet-OnAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only