We narrowed to 14,740 results for: Ung;
-
Plasmid#212140PurposeCargo plasmid for integrating PT7 expression cassette of formate dehydrogenase in genome. Plasmid can be removed by incubating cells at 37 C.DepositorInsertformate dehydrogenase
ExpressionBacterialPromoterPT7Available SinceJan. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL32
Plasmid#174066PurposeEncodes for CIB1 fused to VP16 in S. cerevisiae. Part of optogenetic system.DepositorInsertpGal1-LacO-3NLS-CIB1-VP16-tADH1
TagsFLAGExpressionYeastPromoterpGal1Available SinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
BPK617
Plasmid#179297PurposeExpresses dCas9 fused to VP64DepositorInsertdCas9-VP64
ExpressionMammalianMutationD10A, H840A (catalytically inactive Cas9)PromoterCAGAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJL30
Plasmid#174064PurposeEncodes for 43-8 ZF fused to Cry2. Used for optogenetic recruitment of TF. Used with pJL32.DepositorInsertpGal1-TetO-3xNLS-43-8ZF-Cry2-tADH1
TagsFLAGExpressionYeastPromoterpGal1Available SinceDec. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJL15
Plasmid#174069PurposeExpresses 43-8 zinc finger array fused to CRY2 in S. cerevisiae. Part of optogenetic system.DepositorInsertpGAL-tetO-3xNLS-43-8WT-GS-Cry2-Tadh1
TagsFLAGExpressionYeastPromoterpGal1Available SinceSept. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS41K-mCherry-mNeonGreen (pJJF003)
Plasmid#173459PurposeC-SWAT donor for Seamless tagging, contains mCherry-mNeonGreen tandem fluorescent protein timerDepositorInsertmCherry-mNeonGreen
ExpressionYeastPromoterno promoterAvailable SinceSept. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJBL714
Plasmid#140384PurposeExpresses CtcS-regulated 3WJdB RNA aptamer driven by T7 promoter with the ctcO sequence 5BP downstream from the promoterDepositorInsertT7-ctcO-3WJdB-T
UseSynthetic BiologyAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL720
Plasmid#140390PurposeExpresses QacR-regulated 3WJdB RNA aptamer driven by T7 promoter with the qacO sequence 5BP downstream from the promoterDepositorInsertT7-qacO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJBL722
Plasmid#140392PurposeExpresses TtgR-regulated 3WJdB RNA aptamer driven by T7 promoter with the ttgO sequence 5BP downstream from the promoterDepositorInsertT7-ttgO-3WJdB-T
UseSynthetic BiologyAvailable SinceJuly 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-TMED3-Reverse-Complement
Plasmid#136018PurposeThe Reverse Complement of TMED3 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK3-ZC3H15-Reverse-Complement
Plasmid#136019PurposeThe Reverse Complement of ZC3H15 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmidDepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSKB3SaGGR I206F (JBEI-3678)
Plasmid#110149PurposeSaGGR site-directed mutation of I206FDepositorInsertGGR
ExpressionBacterialMutationSaGGR site-directed mutation of I206FPromoterT7Available SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSKB3SaGGR G91H (JBEI-3677)
Plasmid#110148PurposeSaGGR site-directed mutation of G91HDepositorInsertGGR
ExpressionBacterialMutationSaGGR site-directed mutation of G91HPromoterT7Available SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSKB3SaGGR L377H (JBEI-3683)
Plasmid#110150PurposeSaGGR site-directed mutation of L377HDepositorInsertGGR
ExpressionBacterialMutationSaGGR site-directed mutation of L377HPromoterT7Available SinceJune 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
CMYA5/pBSSK+
Plasmid#97205PurposeCMYA5 (NM_153610, nt 12205 to 12279) in pBSSK+DepositorInsertCMYA5 (CMYA5 Human)
UseUnspecifiedAvailable SinceJuly 28, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
CMYA5/pENTR3C
Plasmid#97408PurposeCMYA5 (NM_153610, nt 12205 to 12279) in pENTR3C, Gateway Entry vectorDepositorInsertCMYA5 (CMYA5 Human)
UseUnspecifiedAvailable SinceJuly 18, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
LGhG-pHG165a
Plasmid#90048PurposeConstitutive expression of a chimeric LacI:GalR transcription repressorDepositorInsertLGhG
ExpressionBacterialPromoterIqAvailable SinceJune 23, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNCMV HPV8 E6 R138S
Plasmid#87659PurposeFlag/HA tagged HPV8 E6 R138SDepositorInsertHPV 8E6
TagsFlag and HAExpressionMammalianMutationR138SPromoterCMVAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLentiN HPV8 E6 K142A
Plasmid#87680PurposeLentiviral expression of HPV8 E6 K142ADepositorInsertHPV 8E6
UseLentiviralTagsFlag and HAMutationK142APromoterCMVAvailable SinceMarch 14, 2017AvailabilityAcademic Institutions and Nonprofits only