We narrowed to 31,049 results for: des.2
-
Plasmid#197250PurposeExpresses the protein of wmiRFP670-2-T2A-HO1 in neurons of C. elegansDepositorInsertwmiRFP670-2-T2A-HO1
ExpressionWormAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-FOXM1-shRNA-#2
Plasmid#89499PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP -2
Plasmid#194322PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP nLAP +2
Plasmid#194307PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertHygro-P2A-nLAP(EGFP)
UseBacterial cloning vectorAvailable SinceFeb. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1/Myc-His(-)-MSulf-2
Plasmid#13008DepositorAvailable SinceOct. 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
SARS-CoV-2 Spike-d18
Plasmid#164583PurposeA mammalian expression vector to express codon-optimized SARS-CoV-2 Spike protein, with a C terminal truncation of 18 amino acids to improve pseudoparticle generation.DepositorInsertSARS-CoV-2 Spike (S SARS-CoV-2)
ExpressionMammalianMutationDeleted amino acids 1256-1273PromoterEF1aAvailable SinceJan. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-SMG6-CDS-2
Plasmid#136047PurposeSMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ef1a-DIO-eGCaMP(2+)
Plasmid#201150PurposeAAV virus production for Cre recombinase dependent expression of eGCaMP(2+)DepositorInserteGCaMP_2+
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJune 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX6-2 SNAP-Syk tSH2
Plasmid#113028Purposefor purification of Syk tSh2. Purified protein will have a snap tag that can be conjugated to fluorescent dyes.DepositorInsertSNAP-Syk tSH2
TagsSNAPExpressionBacterialAvailable SinceAug. 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEBB HA BIR 2-3
Plasmid#25691DepositorAvailable SinceAug. 18, 2010AvailabilityAcademic Institutions and Nonprofits only