We narrowed to 634 results for: des.2
- 
  TypeCollection...SARS-CoV-2 and SARS-CoV is the angiotensin receptor, Angiotensin Converting Enzyme 2 (ACE2)...targeting the SARS-CoV-2 nucleocapsid protein. Brian Geiss 211757 Anti-SARS-CoV-2 Nucleocapsid Protein ...targeting the SARS-CoV-2 nucleocapsid protein. Brian Geiss Plasmids SARS-CoV-2 Plasmids Browse the tables...Antibodies ID Recombinant Antibody Description PI 211756 Anti-SARS-CoV-2 Nucleocapsid Protein [mBG17] Clone...Industry page. ID Plasmid Description Industry PI Additional Addgene resources SARS-CoV-2 Viral Pseudotyping ...SARS-CoV and SARS-CoV-2. Find plasmids related to these genes below. ID Plasmid Description Industry PI Additional... SARS-CoV-2 detection assays Neutralizing nanobody plasmids And more! ID Plasmid Description Industry ...
 - 
  
SARS-CoV-2 Pseudotyped Virus
TypeCollection...Virus SARS-CoV-2 Spike Plasmids Accessory Plasmids Other Resources Mechanisms of SARS-CoV-2 infection remain...protein (MERS, CoV-1, CoV-2), modification, or variant. ID Plasmid Description Mutations Industry PI Due...Browse Addgene's COVID-19 collection of SARS-CoV-2 spike plasmids, packaging plasmids, and reporter plasmids...pseudotyping with SARS-CoV-2 spike protein. Collections... Collections COVID-19 – Viral Pseudotyping SARS-CoV-2 Pseudotyped Virus...spread. As a Biosafety Level 3 (BSL-3) agent, SARS-CoV-2 requires specialized facilities for the study of the...replication-defective virus particles with the SARS-CoV-2 spike (S) glycoprotein on the envelope surface. Pseudotyped... - 
  
Immunology Research Plasmids and Resources
TypeCollection...immunoglobulin heavy diversity 2-15 D2, IGHD215 IGHD2-2 immunoglobulin heavy diversity 2-2 IGHD22 IGHD2-21 immunoglobulin...heat shock 70kDa protein 2 HSP70-2, HSP70-3 HSPA4 heat shock 70kDa protein 4 APG-2, HS24/P52, MGC131852, ...variable 2-33 (non-functional) IGLV233, V1-9 IGLV2-8 immunoglobulin lambda variable 2-8 IGLV28, V1-2 IGLV3...beta 4 DEFB-2, DEFB102, DEFB2, HBD-2, SAP1 EDN1 endothelin 1 ET1, HDLCQ7 EDN2 endothelin 2 ET2, PPET2 ...receptor subfamily 2, group C, member 1 TR2 NR2C2 nuclear receptor subfamily 2, group C, member 2 TAK1, TR2R1...suppression of tumorigenicity 2 - STC1 stanniocalcin 1 STC STC2 stanniocalcin 2 STC-2, STCRP TAC1 tachykinin,...HPS, HPS2, PE AZGP1 alpha-2-glycoprotein 1, zinc-binding ZA2G, ZAG B2M beta-2-microglobulin - CALR calreticulin... - 
  
Fluorescent Protein Guide: Biosensors
TypeCollection...of basal H 2 O 2 levels with peroxiredoxin-based probes Real-time monitoring of basal H 2 O 2 levels with...Belousov Hydrogen Peroxide (H 2 O 2 ) Cytosolic or mitochondrial sensor for H 2 O 2 oxidation (roGFP2-Orp1) ...peroxiredoxin-2-based probe. Nat Commun. 2018 Aug 7;9(1):3145. Hadley Sikes Hydrogen Peroxide (H 2 O 2 ) Monitoring...Photosynthesis-dependent H 2 O 2 transfer from chloroplasts to nuclei provides a high-light signalling mechanism...encoded Ca(2+) indicator with enhanced two-photon absorption. Neurophotonics. 2024 Apr;11(2):024207. doi...Fast red fluorescent calcium sensors (fRCaMP1/2, fRGECO1/2) The kinetic mechanisms of fast-decay red-fluorescent...intracellular Zn(2+) homeostasis. Nat Methods. 2009 Oct;6(10):737-40. Maarten Merkx Zinc eZinCh-2 Zn2+ FRET ... - 
  
Brain Armamentarium
TypeCollection...construct expressing mCherry-tagged channelrhodopsin-2 driven by SST interneuron-targeting enhancer Gordon...construct expressing mCherry-tagged channelrhodopsin-2 driven by PV+ basket cell-targeting enhancer Gordon...construct expressing mCherry-tagged channelrhodopsin-2 driven by chandelier cell-targeting enhancer Gordon...construct expressing mCherry-tagged channelrhodopsin-2 driven by Lamp5 interneuron-targeting enhancer Gordon... - 
  
Rinehart Lab Phosphoprotein Reagents
TypeCollection...Library 111708 Mode #2 Library (NEDD4-2 WW2 domain) Pooled Library 111707 Mode #2 Library (NEDD4 WW2 domain...phosphorylation-dependent protein-protein interactions Figure 2: Mode #1 and Mode #2 phosphosite library configuration for overexpression...Pooled Library 111706 Mode #2 Library (14-3-3σ) Pooled Library 111705 Mode #2 Library (14-3-3β) Pooled Library...phosphorylation-dependent protein-peptide interactions (“Mode #2” expression, Barber et al., 2018). The phosphosite...fluorescence-activated cell sorting (FACS). The Mode #2 phosphosite library contains four different phosphobinding... WW2 domain of NEDD4, and the WW2 domain of NEDD4-2 (Pooled Libraries #111705-8) . Screening kinases The...iSPI_pSer_Subpool#3 Pooled Library 188527 iSPI_pSer_Subpool#2 Pooled Library 188526 iSPI_pSer_Subpool#1 Plasmid ... - 
  
Ginkgo Bioworks COVID-19 Collection
TypeCollection...SARS-CoV-2 in early 2020, Ginkgo Bioworks (Link opens in a new window) used their DNA design and synthesis...Browse Ginkgo Bioworks plasmids to express SARS-CoV-2 viral proteins in several expression systems. Depositor...that would enable researchers to express SARS-CoV-2 viral proteins in several expression systems. Addgene...Use the search bar or sort buttons to find SARS-CoV-2 and common coronvirus plasmids based on: Gene insert...Synthesized by Ginkgo Bioworks, Shared by Addgene: SARS-CoV-2 Plasmids for Many Expression Systems Collection: COVID...Truncated for making pseudovirus (Ctrunc) ID Plasmid Description Mutations Tags Industry Additional Addgene Resources... - 
  
CRISPR Pooled gRNA Libraries
TypeCollection...3rd 1, 2, or 4 49,766 arrays Broad GPP kinome Brunello 75314, 75315 (1 plasmid) 75312, 75313 (2 plasmid...Knockout Human Doench 3rd 2 40,964 Ingolia lab S cerevisiae CRISPRi v1 – barcodes 181005 161769 Inhibition...GPP genome-wide Brunello 73179 (1 plasmid) 73178 (2 plasmid) Knockout Human Doench and Root 3rd 4 76,441...Broad GPP genome-wide Brie 73632 (1 plasmid) 73633 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 78,637...172651 (Set D) Knockout Human Doench and Root 2nd 2 40,710 Inzolia Human CRISPR/Cas12a Multiplex Knockout...3,052 Broad GPP kinome Brie 75317 (1 plasmid) 75316 (2 plasmid) Knockout Mouse Doench and Root 3rd 4 2,852...MinLibCas9 Library 164896 Knockout Human Garnett 3rd 2 37,722 Green monkey (Chlorocebus sabaeus) sgRNA library... - 
  
Plasmids for Stem Cell Research
TypeCollection...mouse somatic cells. Cell Stem Cell. 2008 Feb 7. 2(2):151-9. Jaenisch Lentivirus Mouse Polycistronic, ... cell reprogramming factors and wait for cells to de-differentiate. However it may be difficult to decide...Nature of Induced Pluripotency. Cell. 2015 Jul 16;162(2):412-24. Mikkelsen Lentivirus Human Expression of ...self-replicative RNA. Cell Stem Cell. 2013 Aug 1;13(2):246-54. Dowdy Adenovirus Mouse Non-integrating expression...reprogramming in mouse. Cell Stem Cell. 2008 Mar 6. 2(3):230-40. Hochedlinger MMLV-derived Retrovirus Mouse...Lentiviral Human Small molecules enable neurogenin 2 to efficiently convert human fibroblasts into cholinergic... - 
  
Zhang Lab CRISPR Page
TypeCollection...SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n, D10A nickase) + CRISPR RNA array... system - lentiCRISPR - sgRNA and SpCas9 together 2 vector system - lentiCas9-Blast and lentiGuide-Puro...two MS2 RNA aptamers at the tetraloop and stemloop 2 The MS2-P65-HSF1 activation helper protein Full references...backbone with MS2 loops at tetraloop and stemloop 2 and EF1a-zeo resistance marker. Contains BsmBI sites...inverted terminal repeats (ITR) from AAV serotype 2. SaCas9 only: This plasmid ( PX600, #61592 ) contains...Epub 2013 Aug 29. Erratum in: Cell. 2013 Oct 10;155(2):479-80. PubMed . Genome engineering using the CRISPR-Cas9..., Scott DA, Mikkelsen TS, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. Science . 2014 Jan 3;343(6166... - 
  
Allen Institute for Cell Science Plasmid Collection
TypeCollection...Transcription factor SOX-2 Transcription Factor 124607 ACTN2-mEGFP AICSDP-63 mEGFP Alpha-actinin-2 Sarcomeric z-disks...101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP AICSDP-19 mEGFP LAMP... AICSDP-83 mEGFP EZH2 Polycomb repressive complex 2 164500 POLR2A-mEGFP AICSDP-117 mEGFP RPB1 RNA polymerase...mEGFP AICSDP-77 mEGFP Telomeric repeat-binding factor 2 (TRF2) Telomeres 168799 CTCF-mEGFP AICSDP-144 mEGFP...Mitochondria 87424 DSP-mEGFP AICSDP-9 mEGFP Desmoplakin Desmosomes 87425 ACTB-mEGFP AICSDP-15 mEGFP Beta-actin...human cell lines of their choice. For a full description of how to use these plasmids, check out Plasmids... - 
  
Genetic Code Expansion
TypeCollection...48696 pANAP AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Peter...Mammalian TAG Huiwang Ai 73544 pEvol-pAcFRS.2.t1 pAcFRS.2.t1 E. coli p-acetyl-l-phenylalanine (pAcF) Bacterial...Bacterial TAG Farren Isaacs 73546 pEvol-pAzFRS.2.t1 pAzFRS.2.t1 E. coli p-azido-l-phenylalanine (pAzF) Bacterial..._AnapRS AnapRS E. coli 3-(6-acetylnaphthalen-2-ylamino)-2-amino-propanoic acid (Anap) Mammalian TAG Simon...archaeon S-(4-cyanopyridin-2-yl)-L-cysteine (CysCNP) and S-(4-cyanopyrimidin-2-yl)-L-cysteine (CysCNPym)...Jesse Rinehart 71403 pCMV-DnpK PylRS M. barkeri N6‐(2‐(2,4‐dinitrophenyl)acetyl)lysine (DnpK) Bacterial,...pDule-IBBN (G2) IBBN (G2) synthetase M. jannaschii 4-(2′-bromoisobutyramido)-phenylalanine (IBBN) and structurally... - 
  
Rett Syndrome
TypeCollection... mutations in the gene methyl-CpG binding protein 2 ( MECP2 ). MECP2 Rett syndrome is an X-linked disorder...in transcriptional repression, activity dependent de-repression, chromatin remodeling, gene activation...X-linked MECP2, encoding methyl-CpG-binding protein 2. Nat Genet . 23, 185–188. (Link opens in a new window... Cuddapah et al. 2014. Methyl-CpG-binding protein 2 (MECP2) mutation type is associated with disease severity... Specific mutations in methyl-CpG-binding protein 2 confer different severity in Rett syndrome. Neurology...males with mutations in Methyl-CpG binding protein 2. Am J Med Genet B Neuropsychiatr Genet . 180, 55–67...species (mouse or human) Mutation ID Plasmid Description Gene/Insert Mutations PI Return to top External... - 
  
AAV Packaged on Request
TypeCollection...Total Volume Minimum Titer Typical Titer Small NEW 2 × 100 µL aliquots 0.2 mL 4 × 10 12 GC/mL* 1 × 10 13...yields are generally lower, with a minimum titer of 2 × 10 12 GC/mL and a typical titer of 7 × 10 12 GC/... 10 weeks. This breaks down as follows: Request 1–2 days Look for the banner on an eligible plasmid page... your request. We will send you an email within 1-2 days with a response. Most requests will be approved...make sure it is ready for your experiments. Shipping 2–7 days We will email you with tracking information...all-in-one pricing for viral vector preps, which includes MTA facilitation, DNA amplification, and high-... - 
  
DNA Service - Cloning Grade DNA
TypeCollection...Can I order more than 2 µg of cloning grade DNA? At this time, to order more than 2 µg of a single plasmid...plasmids in bacterial stabs. DNA Service Details Amount 2 µg Volume 20 µl Concentration 100 ng/µl (± 5 ng/µl...Plasmids Available as Cloning Grade DNA ID Plasmid Description Industry PI FAQ What Quality Control analyses...cloning grade DNA into cells? Cloning grade DNA is designed for use in cloning applications. Direct transfection... - 
  
Penn Vector Core Partnership with Addgene
TypeCollection...James M. Wilson AV-2-27056 27056-AAV2 pAAV-Ef1a-DIO EYFP Control Karl Deisseroth AV-2-ALL854 51502-AAV2...Hongkui Zeng AV-2-PV0101 105530-AAV2 pAAV.CMV.PI.EGFP.WPRE.bGH Control James M. Wilson AV-2-PV0101 105530...Wilson AV-2-PV1090 105537-AAV2 pENN.AAV.CMVs.Pl.Cre.rBG Cre Recombinase James M. Wilson AV-2-PV2004 105545...Wilson AV-2-26967M 100049-AAV2 pAAV.hSynap.ChETA(E123T/H134R)-eYFP.WPRE.hGH Karl Deisseroth AV-2-35505 35505...EYFP Karl Deisseroth AV-2-PV0102 105531-AAV2 pAAV.CMV.LacZ.bGH James M. Wilson AV-2-PV1917 105541-AAV2 pENN.AAV.CamKII0.4...pAAV.CMV.PI.EGFP.WPRE.bGH Control James M. Wilson AV-2-PV1963 105542-AAV2 pENN.AAV.CB7.CI.eGFP.WPRE.rBG Control... pAAV-Syn-ChrimsonR-tdT Optogenetics Ed Boyden AV-2-26969P 26969-AAV2 pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics... - 
  
Synthetic Biology - Assembly Standards Guide
TypeCollection...overview of the most common methods. BioBrick BioBrick-2 BglBrick Silver Standard Freiburg Standard BioBrick...visit iGEM: BioBrick (RFC 10) Back to Top BioBrick BB-2 (RFC 12) Prefix: GAATTC GCGGCCGC T ACTAGT G Prefix...XbaI, SapI For more info, visit iGEM: BioBrick BB-2 (RFC 12) Back to Top BglBrick – Berkeley Standard ...after the promoter, and so on. The following table provides information for the assembly standards most commonly...will need to be reverse complimented for primer design. The restriction enzymes used for assembly are ..., NotI , PstI Scar: GCTAGT Features: 6 bp scar encodes Ala-Ser; Allows for in-frame fusions; NheI is rare...Enzymes: BamHI , Xhol Scar: GGATCT Features: Scar encodes Gly-Ser in-frame with prefix start codon; Employs... - 
  
CRISPR History and Development for Genome Engineering
TypeCollection...transcribed to make the pre-CRISPR RNA (pre-crRNA). (2) The pre-crRNA is processed into individual crRNAs...2015. Class 1 (Multi-subunit effector complex) Class 2 (Single multi-domain effector) Type I (Cas3) Type ... with unprecedented speed and specificity. Figure 2: An overview of CRISPR and NHEJ/HDR. The Cas9/gRNA...regulation of transcription in eukaryotes. Cell . 154(2):442-51. PMID: 23849981 Ishino Y, Shinagawa H, Makino...X, Scott DA, Mikkelson T, Heckl D, Ebert BL, Root DE, Doench JG, Zhang F. 2014. Genome-Scale CRISPR-Cas9...Cpf1 Is a Single RNA-Guided Endonuclease of a Class 2 CRISPR-Cas System. Cell . 163(3):759-71. PMID: 26422227...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The CRISPR revolution shows... - 
  
Lentiviral Prep Service
TypeCollection...Barcode Library Version 2 Ready-to-use lentiviral particles carrying version 2 of the CellTag barcoding...barcoding library. Version 2 of the Celltag library contains 4934 barcodes to combinatorially index cells for... Guide to Plasmid Pooled Libraries . ID Name Description Genes/Insert Selection PI Human knockout pooled...2A-Blast-WPRE) Zhang Pooled Barcoding Libraries ID Name Description PI 115643 Morris CellTag Barcode Library Version...Version 1 of the Celltag library contains 19973 barcodes to combinatorially index cells for single-cell...Version 3 of the Celltag library contains 5737 barcodes to combinatorially index cells for single-cell... - 
  
Validated gRNA Sequences
TypeCollection...23792628 Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Mashimo Kit-2 R. norvegicus CTAACGTTCCAGCGCTCGTT 60970 cut S. pyogenes 24967838 Mashimo Kit-2 R. norvegicus... & Lim swan-2 C. elegans ACAAATTGATATCCAATCA 66100 cut S. pyogenes 25249454 Seydoux swan-2 C. elegans ...AMPK alpha 2 H. sapiens GTCAGCCATCTTCGGCGCGCG 74376 nick S. pyogenes 26816379 Shaw AMPK alpha 2 H. sapiens.... pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA 59912...also like... CRISPR Guide CRISPR Protocols gRNA Design Tools CRISPR Blog Posts The table below lists gRNA...the particular conditions of the experiment as described in the associated article (listed below by PubMed...