We narrowed to 28,408 results for: cmv promoter
-
Plasmid#193821PurposeCMV overexpression of ChemoG-NAD in mammalian cell linesDepositorInsertChemoG-NAD
ExpressionMammalianMutationEGFP:A206K, T225R; HT7: L271EPromoterCMVAvailable SinceJune 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDNA5/FRT/TO_CalR-HaloTag7-P30-SNAP-tag-KDEL
Plasmid#182012PurposeCMV overexpression of HaloTag7 and SNAP-tag fusion in the endoplasmic reticulum of mammalian cell linesDepositorInsertCalR-HaloTag7-P30-SNAP-tag-KDEL
ExpressionMammalianPromoterCMVAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMAL
Plasmid#161783PurposeGateway destination vector with bidirectional CMV-PGK promoter for modest expression of gene of interest and GFP.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterBidirectional minhCMV and hPGKAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
-
psgRNA-GST-EGFP-GPIBY55
Plasmid#213720PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPIBY55 under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
psgRNA-GST-EGFP-GPICEAM7
Plasmid#213721PurposeTo express a single-guide RNA under a U6 promoter, accompanied by the expression of the affinity sorting tag GST-EGFP-GPICEAM7 under a CMV promoter.DepositorInsertEGFP
UseCRISPRTagsGSTPromoterCMVAvailable SinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianPromotermouse U6Available SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.CMVs.Pl.Cre.rBG (AAV rh10)
Viral Prep#105537-rh10PurposeReady-to-use AAV rh10 (similar to AAV10) particles produced from pENN.AAV.CMVs.Pl.Cre.rBG (#105537). In addition to the viral particles, you will also receive purified pENN.AAV.CMVs.Pl.Cre.rBG plasmid DNA. CMV-driven Cre. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVAvailable SinceJuly 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pN3-mTagBFP-pHluorin-CAAX
Plasmid#178345PurposeExpress a pH insensitive blue fluorencent protein mTagBFP fused to the N-terminal of a membrane targeted pH sensitive green fluorescent protein pHluorin-CAAX under CMV promoterDepositorInsertmTagBFP-pHluorin-CAAX
ExpressionMammalianPromoterCMVAvailable SinceFeb. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cx43-sfGFP
Plasmid#70053PurposeExpresses rat Cx43 (Gja1 CDS) tagged with non-monomerized sfGFP on the C-terminus. CMV promoter.DepositorInsertCx43 (Gja1 Rat)
Tagsnon-monomerized superfolder GFP (V207)Mutationfused in frame to non-monomerized superfolder GFPPromoterCMVAvailable SinceOct. 26, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-NMHC-IIA-3xA
Plasmid#101041PurposeExpresses GFP-MYH9 construct (human myosin IIA) carrying S1943A mutation and S1916A, S1915A mutation, driven by CMV promoter. Thus inhibits CKII and PKC phosphorylation of the tail.DepositorInsertNon-muscle myosin IIA heavy chain (MYH9 Human)
TagsGFPExpressionMammalianMutationS1915A, S1916A, S1943APromoterCMVAvailable SinceNov. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCB268
Plasmid#53363PurposepcDNA3.0-based plasmid encoding fDHFR-UbK48R-Aβ42 13myc under the control of T7 or CMV promoter for 35S-pulse-chase URT-based assays in rabbit reticulocyte extract.DepositorTags13xMyc, Flag, and HAExpressionMammalianPromoterCMVAvailable SinceJune 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pMMACE DEST CMV H2B iRFP
Plasmid#206253PurposeDEST vector for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes H2B iRFP713 under the control of CMV promoter. CRE-Acceptor in MultiBac system.DepositorInsertH2B iRFP713
UseRecombinant baculovirus production, multimate/gat…TagsiRFP713ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 4 CMV GST mTagBFP
Plasmid#206259PurposeENTR Vector 4 for MultiSite Gateway assembly and production of recombinant baculovirus using MultiMate assembly. Encodes mTagBFP localised to Golgi organelles under the control of CMV promoter.DepositorInsertGTS mTagBFP
UseMultimate/gateway entr 4TagsBFGT1 (Golgi localisation peptide)ExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 1 CMV mAG h-Geminin
Plasmid#206281PurposeENTR Vector 1 for MultiSite Gateway assembly. Encodes mAG-hGeminin under the control of CMVDepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMMK ENTR 2 CMV mKO2-hCdt1
Plasmid#206282PurposeENTR Vector 2 for MultiSite Gateway assembly. Encodes mKO2-hCdt1 under the control of CMVDepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-T4DNApol (JO638)
Plasmid#208956PurposeA variant CE1 construct with T4 DNA polymerase (-exo, activity enhanced), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-T4pol-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), T4Pol(-exo;D189A/E191A/L412M)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-PolBeta (JO574)
Plasmid#208953PurposeA variant CE1 construct with human DNA polymerase beta, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-PolBeta-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-TaqStoffel (JO595)
Plasmid#208952PurposeA variant CE1 construct with Taq Stoffel DNA polymerase, expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-TaqStoffel-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
HUHe variant click editor (CE1) - pCMV-T7-DCV-nCas9-EcKlenow (JO608)
Plasmid#208946PurposeA variant CE1 construct with DCV HUH endonuclease, expressed from CMV or T7 promoters.DepositorInsertDCV-XTEN-nSpCas9-BPNLS-EcKlenow(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A); EcKlenow(-exo;D355A/E357A)PromoterCMV and T7Available SinceNov. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF1a_BbsI-gRNA scaffold-EC73-5'-EcoRI-EC73-3'-HDV_pA_pCMV_EGFP-L202S-P2A-mCherry_pA
Plasmid#176461PurposeVector for constructing retron Ec73ncRNA-gRNA chimeric RNA (Ec73 rgRNA), inserting spacer sequence by BbsI digestion and inserting donor sequence by EcoRI digestion. EGFP(L202S)-P2A-mCherry driven by CMVDepositorInsertBbsI-gRNA scaffold-Ec73ncRNA-EcoRI-HDV
UseCRISPRExpressionMammalianPromoterEF1alphaAvailable SinceOct. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
SMN2E7-Fluc-Nluc-reporter
Plasmid#221005PurposeTransiently express SMN2 dual luciferase reporter. Inclusion of E7 produces in-frame stop codon and Firefly luciferase only, while skipping produces both Firefly and Nanoluc. CMV promoter.DepositorInsertFluc-SMN2E7-STOP-Nluc
ExpressionMammalianPromoterCMVAvailable SinceJune 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
miniCRISPRoff-v1
Plasmid#197030PurposeVector encoding a human codon-optimized miniCRISPRoff-v1 driven by CBh promoter, guide RNAs compatible with enOsCas12f1 driven by hU6, and mCherry driven by CMV promoterDepositorInserthumanized miniCRISRPoff-v1
ExpressionMammalianMutationD52R / T132R / D228A / D406APromoterCBh, CMV, hU6Available SinceMay 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-puro_CMV_NES-Kinprola_on-mEGFP
Plasmid#233370PurposeCMV driven expression of the consitutively active kinase activity recorder positive control Kinprola_on fused to mEGFP for neuronal expression through lentivirus transductionDepositorInsertNES-Kinprola_on-mEGFP
UseLentiviralTagsNES and mEGFPPromoterCMVAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLC-HA-Nedd8-P2A-Hygro
Plasmid#124306PurposeLentiviral vector for expression of HA tagged Nedd8-P2A-Hygro casette from a CMV promoterDepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
Plasmid#248061PurposeExpression vector for expression of miCBE-ωRNA v2 driven by chicken β-actin promoter and mCherry driven by CMV promoter.DepositorInsertpU6-RNA-pCAG-bpNLS-miCBE-SV40NLS-bGH polyA-pCMV-mCherry-AmpR
UseCRISPRTagsflagExpressionMammalianMutationnonePromoterCAG, U6Available SinceJan. 5, 2026AvailabilityAcademic Institutions and Nonprofits only -
CMV-CRY2oligo-mcherry-ANXA11(R235Q)
Plasmid#164205PurposeExpresses CRY2oligo-mcherry tagged ANXA11 R235R mutant under CMV promoterDepositorInsertANXA11 (ANXA11 Human)
TagsCRY2oligo-mcherryExpressionMammalianMutationR235QPromoterCMVAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-CRY2oligo-mcherry-ANXA11(D40G)
Plasmid#164204PurposeExpresses CRY2oligo-mcherry tagged ANXA11 D40G mutant under CMV promoterDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-bpNLS-Stab-exin21-eeBxb1-Stab (CJT607)
Plasmid#248212PurposebpNLS-, stabilon-, and exin21-tagged eeBxb1 recombinase, expressed from a CMV promoter.DepositorInsertbpNLS-Stab-exin21-eeBxb1-Stab
UseCRISPR; In vitro transcriptionTagsBPNLSExpressionMammalianMutationeeBxb1(V74A, E229K, V375I)PromoterCMV and T7Available SinceMay 11, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AcrIIC1-NLS(SV40) (KAC208)
Plasmid#134340PurposeCMV and T7 promoter expression plasmid for human codon optimized AcrIIC1 with C-terminal NLS (SV40)DepositorInserthuman codon optimized AcrIIC1
TagsNLS(SV40)ExpressionMammalianPromoterCMV and T7Available SinceMarch 30, 2020AvailabilityAcademic Institutions and Nonprofits only