We narrowed to 7,890 results for: 11
-
Plasmid#224583PurposeUbiquitous expression plasmid with CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage, three membrane split GFP(11) reporter.DepositorInsert3xGFP11
UseCRISPRTagsMembrane Localization SignalMutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pACYCDuet_WTDHFR_WTTS
Plasmid#91226Purposebacterial co-expression of folA (DHFR) and thyA(TS) with a barcode within the noncoding region between the genesDepositorInsertsfolA
thyA
Tags6xHisExpressionBacterialPromoterT7Available SinceJune 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCFJ906
Plasmid#44472DepositorInsertMinimal Mos1, unc-119, [4-3] Gateway
UseGateway destination vectorAvailable SinceJuly 30, 2013AvailabilityAcademic Institutions and Nonprofits only -
P[acman]-Alpha2
Plasmid#165859PurposeAlpha2 Basic cloning vector GB2.0 compatible P[acman]-derived backbone. Allows for copy induction from low to high using AutoFOS or similar. Requires EPI300 bacterial strain (DH10B Derived) or similar. uses blue-white screeningDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceSept. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pdgfra-T2A-H2B-eGFP donor
Plasmid#113120PurposeDonor plasmid for knock-in T2A-H2B-eGFP to the c-terminal of mouse Pdgfra coding sequenceDepositorInsertPdgfra donor region including homology arms and T2A-H2B-eGFP (Pdgfra Mouse, Synthetic)
UseSynthetic BiologyAvailable SinceAug. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nDsRedFL-intron
Plasmid#177804PurposeAn intron is inserted into the DsRed gene with a nuclear transfer signal and a 3xFlag tag. The intron can be digested with EcoRV and any pre-miRNA can be inserted.DepositorInsertintron
ExpressionMammalianAvailable SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGinB-8X(GGS)-dCas9-FLAG-NLS
Plasmid#81205PurposeCMV promoter driving expression of GinB catalytic domain fused with linker to dCas9 in the order shown. Has a FLAG and NLS tag on the c-terminusDepositorInsertpGinB-8X(GGS)-dCas9-FLAG-NLS
ExpressionMammalianPromoterCMVAvailable SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMSP2
Plasmid#26282DepositorInsertMSP2
Tags6-HisExpressionBacterialMutationsynthetic gene of dimer of deletion mutant (1-43)…Available SinceApril 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pMRX-INU-TEX264 LIR4A-FLAG
Plasmid#128259PurposeExpresses TEX264 LIR4A in mammalian cellsDepositorInsertTEX264 LIR4A (TEX264 Human)
UseRetroviralTagsFLAGExpressionMammalianMutationChanged FEEL (aa 273-276) to alaninesPromoterCMVAvailable SinceJuly 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRK5 mFz8CRD-IgG
Plasmid#16689DepositorAvailable SinceMay 16, 2008AvailabilityAcademic Institutions and Nonprofits only -
EYFP-Clathrin
Plasmid#20921DepositorAvailable SinceAug. 5, 2009AvailabilityAcademic Institutions and Nonprofits only -
GFP-V96 ELP
Plasmid#67853PurposeGFP Fluorescent Elastin-like Polypeptide(VPGVG) with 96 repeats containing Valine guest residuesDepositorInsertGFP fused to ELP (VPGVG) repeated 96 times
TagsGFP fused to N-terminal of ELPExpressionMammalianPromoterT7Available SinceOct. 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFosill-3
Plasmid#89697Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - CA
Plasmid#65424PurposeRhoC CA biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC Q63LDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, Q63L in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
RhoC FLARE.sc mCer, mVenus - DN
Plasmid#65423PurposeRhoC DN biosensor single chain; mCerulean-tagged ROCK-RBD, mVenus-tagged RhoC T19NDepositorInsertRBD, mCerulean, mVenus, RhoC
ExpressionBacterial, Insect, and Mamm…MutationT153M in mVenus, T19N in RhoCAvailable SinceAug. 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pFosill-2
Plasmid#89696Purposeto make Fosmids that can be converted into Illumina sequencable librariesDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFBD-ESCRT 0
Plasmid#21499DepositorInsertpFastBac Dual-His/MBP/Hrs-GST/STAM1 (STAM Human, Mouse)
TagsGST and His-MBPExpressionInsectMutationnoneAvailable SinceSept. 9, 2009AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xControlgRNA
Plasmid#224568PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer and chicken beta actin promoter), three Control gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCJH002_10xHis-MBP-TEVcs-Cas12c(4)_Amp
Plasmid#183069PurposeBacterial protein expression plasmid of wild-type Cas12c_4. This is a R965H version of the Cas12c in Harrington et al., 2020.DepositorInsertCas12c_4
UseCRISPRTagsHis10 and MBPExpressionBacterialMutationWild-typeAvailable SinceJune 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only