We narrowed to 6,056 results for: Streptococcus
-
Plasmid#235081PurposeExpresses SpRY-Tad-CBE(ACC2) in mammalian cells.DepositorInsertTad-CBE(ACC2)-SpRY Cas9 D10A
UseCRISPRTags2xUGI, bpNLS and bpNLSExpressionMammalianAvailable sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#2-puro
Plasmid#231980PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-multi-CRISPR-sgMlkl_#1-puro
Plasmid#231979PurposeKnockout mouse MlklDepositorInsertsgRNA with Cas9 with puromycin resistance (Mlkl Mouse)
UseCRISPR and LentiviralAvailable sinceFeb. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX379 Legionella pneumophila str. Paris Cas9
Plasmid#68316PurposeLegionella pneumophila str. Paris Cas9DepositorInsertLpCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable sinceSept. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX391 Sphaerochaeta globus str. Buddy Cas9
Plasmid#68328PurposeSphaerochaeta globus str. Buddy Cas9DepositorInsertSgCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBXMCS-2 Pconstitutive-sgRNA(Sth3)_gcrA1
Plasmid#133340Purposefor constitutive expression of a single guide RNA from Streptococcus thermophilus #3 with a seed region that targets gcrA gene's promoter on the non-template strand in Caulobacter crescentusDepositorInsertsgRNA_gcrA
UseCRISPRPromoterconstitutiveAvailable sinceJan. 22, 2020AvailabilityAcademic Institutions and Nonprofits only -
zCREST3:Cas9green; T3_gRNA
Plasmid#199335PurposepDEL161; transgenic construct to express cell-specific Cas9 in sensory neurons; ubiquitous nrg1 type III sgRNADepositorInsertszCREST3
Cas9
nrg1 type III sgRNA
UseTol2 destination vectorAvailable sinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
PX379 Legionella pneumophila str. Paris Cas9
Plasmid#68316PurposeLegionella pneumophila str. Paris Cas9DepositorInsertLpCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable sinceSept. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
PX391 Sphaerochaeta globus str. Buddy Cas9
Plasmid#68328PurposeSphaerochaeta globus str. Buddy Cas9DepositorInsertSgCas9
UseCRISPRTagsHA and NLSExpressionMammalianPromoterCMVAvailable sinceAug. 24, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pT7-SpCas9_sgRNA-site1 (RTW443)
Plasmid#160136PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #1DepositorInsertSpCas9 sgRNA with spacer #1 (spacer=GGGCACGGGCAGCTTGCCGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available sinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS848∙CsR
Plasmid#199240PurposeExpresses Streptococcus pyogenes' cas9 and a tailored sgRNA for counterselection in gram-negative bacteriaDepositorInsertgRNA scaffold - Gm resistance cassette - incP oriT
UseCRISPR and Synthetic BiologyPromoterPEM7Available sinceOct. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAEL007097-Cas9
Plasmid#100705PurposeThe promoter of AAEL007097 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL007097-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL007097 and Opie2Available sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAEL007097-Cas9
Plasmid#100705PurposeThe promoter of AAEL007097 drive expression of Streptococcus pyogenes Cas9 gene in Aedes aegyptiDepositorInsertsAAEL007097-hspcas9-GFP
Opie2-dsRed
UseCRISPRTagsGFP and dsREDExpressionInsectPromoterAAEL007097 and Opie2Available sinceOct. 10, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAGT6471
Plasmid#219428PurposeModule of intronized NLS-SpCas9-NLS for N-terminal and C-terminal tag fusions (AGGT_N-SpCas9i-N_TTCG)DepositorInsertAGGT_NLS-SpCas9i-NLS(no stop)_TTCG
UseMoclo compatible level 0 moduleAvailable sinceJuly 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SpCas9-CBE6a
Plasmid#215819PurposeExpress CBE6a (with SpCas9) in mammalian cellsDepositorInsertCBE6a-SpCas9-2xUGI (cas9 )
ExpressionMammalianAvailable sinceMarch 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN053
Plasmid#220047PurposeMammalian expression of type III-A crRNA from Streptococcus thermophilus within 5`UTR of mCherry transcriptDepositorInsertcrRNA-mCherry
ExpressionMammalianAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAN102
Plasmid#220045PurposeMammalian expression of type III-A crRNA and Cas6 crRNA-processing ribonuclease from Streptococcus thermophilusDepositorInsertcrRNA; Cas6
ExpressionMammalianAvailable sinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only