We narrowed to 1,070 results for: Superfolder GFP
-
Plasmid#139931PurposeM. magneticum/E. coli shuttle vector (pMGT and p15A ori)DepositorInsertsfGFP
ExpressionBacterialPromoterPJ23119Available SinceMarch 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLP-sfgfp
Plasmid#209994PurposeContains Level 0 Part: Coding sequences (sfGFP) for the construction of Level 1 plasmidsDepositorInsertsfGFP
ExpressionBacterialAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBAD/HisB (TIRSTD)-sfGFP
Plasmid#189674Purposetitratable expression of sfGFP in bacteriaDepositorInsertsfGFP
TagsHis-T7-EKExpressionBacterialPromoterpBADAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP01
Plasmid#186260PurposesfGFP under light light responsive PEL222 promoterDepositorInsertsfGFP
ExpressionBacterialPromoterPEL222 (GGTAGCCTTTAGTCCATGTTAGCGAAGAAAATGGTTTGTTA…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xG1 PylT A41AA C55A sfGFP 150TAG
Plasmid#154770Purposeplasmid with 4xG1 PylT cassette (G1 PylT mutant A41AA C55A) and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in GFP reporter, G1 PylT with A41AA and C5…PromoterEF1Available SinceOct. 1, 2020AvailabilityAcademic Institutions and Nonprofits only -
FRP272
Plasmid#159305PurposeYeast tagging vector to create gene fusion with sfGFP under KanMX selectionDepositorTypeEmpty backboneExpressionYeastAvailable SinceSept. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFA-GFP
Plasmid#133009PurposepFA carrying a sfGFP geneDepositorInsertsfGFP
Tags6xhisExpressionBacterialPromotertetRAvailable SinceMay 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET sfGFP(150TAG)
Plasmid#133455Purposeexpresses sfGFP with an unnatural amino acid at the 150th position in bacterial cellsDepositorInsertsfGFP
TagsHisExpressionBacterialPromoterT7Available SinceNov. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTHSSe_32
Plasmid#109236PurposePUPsp2 GFP reporterDepositorInsertsfGFP
ExpressionBacterialPromoterPUPsp2Available SinceJuly 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pVRb32_1122
Plasmid#49722DepositorInsertsfgfp
UseSynthetic BiologyExpressionBacterialPromoterPecf32_1122Available SinceJan. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRb25_up4311
Plasmid#49717DepositorInsertsfgfp
UseSynthetic BiologyExpressionBacterialPromoterPecf25_up4311Available SinceJan. 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRb19_up1315
Plasmid#49713DepositorInsertsfgfp
UseSynthetic BiologyExpressionBacterialPromoterPecf19_up1315Available SinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pVRb01_syn20
Plasmid#49704DepositorInsertsfgfp
UseSynthetic BiologyExpressionBacterialPromoterPecf01_syn20Available SinceJan. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-CI
Plasmid#51565PurposeExpression of bacteriophage lambda CI for protein purification (Intein-chiting binding domain fussion, New England Biolabs pTXB1 backboneDepositorInsertcI
TagsIntein-Chiting Binding DomaninExpressionBacterialAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-KAR2-msGFP2-HDEL
Plasmid#160468PurposeYeast integration vector for the gene replacement of S. cerevisiae KAR2 fused to msGFP2 with an ER retrieval signalDepositorInsertKAR2-msGFP2-HDEL
ExpressionYeastAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET29b-H6_Streptavidin_sfGFP
Plasmid#124296PurposeHis6-tagged Streptavidin GFP fusion proteinDepositorInsertHis6 tag - TEV protease site - T7 tag - Streptavidin (15-159) - superfolder GFP
TagsHis6 and T7 tagsExpressionBacterialAvailable SinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-CRP/CAP
Plasmid#51563PurposeExpression of E. coli CRP/CAP for protein purification (Intein-chiting binding domain fussion, New England Biolabs pTXB1 backboneDepositorInsertCRP/CAP
TagsIntein-Chiting Binding DomaninExpressionBacterialAvailable SinceMarch 25, 2014AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-D134*
Plasmid#191110PurposeAn E. coli sfGFP reporter with one TAG at position 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLei-sfGFP-V2*D134*Y152*
Plasmid#191112PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134 & 152DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 & Y152 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only