We narrowed to 3,140 results for: cat.3
-
Plasmid#86307PurposeEncodes gRNA for 3' target of human KDM6ADepositorInsertgRNA against KDM6A (KDM6A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTA231-p.Syn-Dendra2Hfx
Plasmid#164660Purposeexpression of H. volcanii codon-optimized Dendra2DepositorInsertDendra2Hfx
UseArchaeal expressionTagsExpressionMutationcodon-optimization for Haloferax volcaniiPromoterp.SynAvailable sinceFeb. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_1
Plasmid#86299PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM6A_2
Plasmid#86308PurposeEncodes gRNA for 3' target of human KDM6ADepositorInsertgRNA against KDM6A (KDM6A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_FOXP1_2
Plasmid#86300PurposeEncodes gRNA for 3' target of human FOXP1DepositorInsertgRNA against FOXP1 (FOXP1 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_CEBPA_2
Plasmid#86359PurposeEncodes gRNA for 3' target of human CEBPADepositorInsertgRNA against CEBPA (CEBPA Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX330_MED13_iso1_1
Plasmid#135751PurposeEncodes gRNA for 3' target of human MED13_iso1DepositorInsertMED13_iso1 gRNA (MED13 Human)
UseCRISPRTagsExpressionMutationPromoterU6Available sinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#1
Plasmid#163388PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorInsertBmpr2 (Bmpr2 Mouse)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
gRNAs[bTub+Tra].1046D
Plasmid#112693Purposeexpress two gRNA targeting bTub & Tra under dU6-3 promoterDepositorInsertU6.3-gRNA[bTub] & U6.3-gRNA[Tra] (tra Fly)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_1
Plasmid#86321PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KDM3A_2
Plasmid#86322PurposeEncodes gRNA for 3' target of human KDM3ADepositorInsertgRNA against KDM3A (KDM3A Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_KLF11_2
Plasmid#86315PurposeEncodes gRNA for 3' target of human KLF11DepositorInsertgRNA against KLF11 (KLF11 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSCIP-hCD69-TdTomato
Plasmid#154095PurposeSelf-Cutting and Integrating CRISPR backbone targeting human CD69 promoter with TdTomato reporter transgeneDepositorInserts[5HA]-P2A-tdTomato-[3HA]
hCD69 targeting sgRNA - AGCTCTTTGCATCCGGAGAG
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceJuly 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-mTDGa.1
Plasmid#81051Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
UseTags6HISExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available sinceAug. 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-deGFP
Plasmid#184840PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the mRNA of deGFP and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the the mRNA of deGFP, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyTagsExpressionBacterialMutationPromoterJ23119 and lac promoterAvailable sinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTG-mTDGa.1
Plasmid#81049Purposebacterial expression of catalytically dead murine TDGDepositorInsertTDG (Tdg Mouse)
UseTagsGSTExpressionBacterialMutationasparagine 151 changed to alaninePromoterT7Available sinceSept. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-NES-jRGECO1a-WPRE
Plasmid#216276PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of red fluorescent calcium indicator jRGECO1aDepositorInsertNES-jRGECO1a
UseAAV and Cre/LoxTags6XHIS and XpressExpressionMutationPromoterhuman synapsin 1 (hSyn)Available sinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
YCe2741 HC_Kan_EF1ap_p18
Plasmid#100698Purposepart designed to occupy position 18 of EMMA. Functional category: Constitutional promoterDepositorInsertEF1a promoter (EEF1A1 Human)
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceNov. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
Akaby
Bacterial Strain#184224PurposeAkaby is a RecB knockout E. coli strain, made for cell-free expression system for linear templates.DepositorBacterial ResistanceKanamycinAvailable sinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only