We narrowed to 4,237 results for: pes
-
Plasmid#121423PurposesgYAP-2 sequence: GAGATGACTTCCTGAACAGTG. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-2
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOAD eIF4G1 (1-341)
Plasmid#196833PurposeExpesses S.cerevisiae eIF4G1 amino acids 1-341 as Gal4 activation domain fusion.DepositorInserteIF4G1 (TIF4631 Budding Yeast)
UseTagsGal4ExpressionYeastMutationamino acids 1-341PromoterADHAvailable sinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
LLP754_L2pV1_NOT_FRT_Rluc_1IF_lacZ
Plasmid#192399PurposeOff state for the first generation of NOT gates, which target the Rluc CDS to repress expression via its FRT sites.DepositorInsertAct2::FRT-Rluc-FRT
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP753_L2pV1_NOT_FRT_Rluc_0I_lacZ
Plasmid#192398PurposeOn state for the first generation of NOT gates, which target the Rluc CDS to repress expression via its FRT sites.DepositorInsertAct2::FRT-Rluc-FRT
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP730_L2_pV01_0I_FRT-OCS-TB-rLUC_TCTP-fLUC
Plasmid#192373PurposeTo test for the repressive potential of the OCS and Transcription Block (TB) fusion with the FRT sites around it.DepositorInsertAct2::FRT-OCS-TB-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP733_L2_pV01_0I_FRT-uORF-rLUC_TCTP-fLUC
Plasmid#192376PurposeTo test for the repressive potential of the conserved peptide uORF from AT1G36730 with the FRT sites around it.DepositorInsertAct2::FRT-uORF-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP727_L2_pV01_0I_TMV-rLUC_TCTP-fLUC
Plasmid#192370PurposeTo control for variation introduced to the gene circuits, Rluc expression not affected by the introduction of terminators or recombination target sites.DepositorInsertAct2::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP732_L2_pV01_0I_FRT-35Ster-Rluc_lacZ
Plasmid#192375PurposeTo test for the repressive potential of the 35S terminator from CaMV with the FRT sites around it.DepositorInsertAct2::FRT-35Ster-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP729_L2_pV01_0I_FRT-OCS-rLUC_TCTP-fLUC
Plasmid#192372PurposeTo test for the repressive potential of the OCS with the FRT sites around it. Then used as a control to represent the off state of many cicuits.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP731_L2_pV01_0I_FRT-OCStrunc-Rluc_lacZ
Plasmid#192374PurposeTo test for the repressive potential of the OCS variant (truncation) with the FRT sites around it.DepositorInsertAct2::FRT-OCStrunc-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP741_L2pV1_CR_B3RT-Rluc_TCTP-FlpO_lacZ
Plasmid#192385PurposeTo test for if Flp is able to de-repress a circuit with B3RT, to rule out cross-reactivity between these recombinases.DepositorInsertAct2::B3RT-OCS-B3RT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP742_L2pV1_CR_FRT-Rluc_TCTP-B3o_lacZ
Plasmid#192386PurposeTo test for if B3 is able to de-repress a circuit with FRT, to rule out cross-reactivity between these recombinases.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP757_L2pV3_NOT_B3RT_Rluc_0I_lacZ
Plasmid#192404PurposeOn state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its B3RT sites.DepositorInsertB3RT-Act2-B3RT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP756_L2pV1_NOT_B3RT_Rluc_1IB_lacZ
Plasmid#192401PurposeOff state for the first generation of NOT gates, which target the Rluc CDS to repress expression via its B3RT sites.DepositorInsertAct2::B3RT-Rluc-B3RT
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP755_L2pV1_NOT_B3RT_Rluc_0I_lacZ
Plasmid#192400PurposeOn state for the first generation of NOT gates, which target the Rluc CDS to repress expression via its B3RT sites.DepositorInsertAct2::B3RT-Rluc-B3RT
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP714_L2pV3_NOT_FRT_Rluc_0I_lacZ
Plasmid#192402PurposeOn state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its FRT sites.DepositorInsertFRT-Act2-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP758_L2pV3_NOT_B3RT_Rluc_1IB_lacZ
Plasmid#192405PurposeOff state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its B3RT sites.DepositorInsertB3RT-Act2-B3RT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP713_L2pV3_NOT_FRT_Rluc_1IF_lacZ
Plasmid#192403PurposeOff state for the second generation of NOT gates, which target the Rluc promoter to repress expression via its FRT sites.DepositorInsertFRT-Act2-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP738_L2pV1_1I_Act2_FRT_OCS_s35S_Flp_lacZ
Plasmid#192381PurposeTo test if the 35S promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP736_L2pV1_1I_Act2_FRT_OCS_TCTP_Flp_lacZ
Plasmid#192379PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output (despite the presence of the lacZ endlinker).DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP734_L2pV1_1I_OCS-rLUC_F-NOS-FlpO
Plasmid#192377PurposeTo test if the NOS promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
LLP735_L2pV1_1I_OCS-rLUC_F-TCTP-FlpO
Plasmid#192378PurposeTo test if the TCTP promoter can drive the Flp recomhinase in order to remove the OCS terminator and increase circuit output.DepositorInsertAct2::FRT-OCS-FRT::Rluc
UseSynthetic BiologyTagsPESTExpressionPlantMutationPromoterAvailable sinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9339 (pgRNA_VII-1_NatMX)
Plasmid#161591PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9340 (pgRNA_VIII-1_NatMX)
Plasmid#161592PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site VIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9342 (pgRNA_XIII-1_NatMX)
Plasmid#161594PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XIII-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB9344 (pgRNA_XVI-1_NatMX)
Plasmid#161596PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XVI-1DepositorInsertguiding RNA
UseCRISPR and Synthetic BiologyTagsExpressionYeastMutationPromoterAvailable sinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTW927
Plasmid#115961PurposeORF insert for replicon MoCloDepositorInsertLvl0 ORF TetR-2A-mKate-PEST GG
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1371-sgYAP-10
Plasmid#121424PurposesgYAP-10 sequence: GTGCTGTCCCAGATGAACGTC. Lentiviral mouse U6 (mU6) promoter-driven expression vector that coexpessed Puro-T2A-mCherry from a CMV promoter.DepositorInsertsgYAP-10 (GTGCTGTCCCAGATGAACGTC)
UseCRISPR and LentiviralTagsmCherryExpressionMammalianMutationPromotermouse U6Available sinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
OpenLoopControl
Plasmid#59895Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Does not contain the target containing Vamp3 3′UTRDepositorInsertmCherry with intron containing the mouse mir-124–3
UseTagsPESTExpressionMammalianMutationPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available sinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
CMV-LUC2CP/ARE
Plasmid#62857PurposeSplicing reporter control (no intron) with elements to shorten the half-life of the luciferase protein as well as the luciferase mRNA.DepositorInsertLuciferase
UseLuciferaseTagsExpressionMammalianMutationdestabilizing sequences (DS) added to the C termi…PromoterCMVAvailable sinceApril 3, 2015AvailabilityAcademic Institutions and Nonprofits only