We narrowed to 32,596 results for: uros
-
Plasmid#192670PurposeLentiviral expression of sgRNA targeting hASCL1 promoter to activate human ASCL1 transcriptionDepositorInsertHuman ASCL1 activating gRNA #1 (ASCL1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceDec. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FLAG-2xSTREP-CCND3-Puro
Plasmid#172619PurposeRetroviral vector for the constitutive expression of FLAG-2xSTREP-tagged cyclin D3 and a puromycin resistance marker in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMVSP6-NR2F2-SV40-PURO
Plasmid#138361PurposeLentiviral plasmid contains human NR2F2 driven by CMVSP6 and puromycin resistance for selectionDepositorInsertHuman NR2F2, with puromycin driven by SV40 for selection
ExpressionMammalianAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDestTol2CG2-Neurog1-Magneto2.0-p2A-mCherry-pA
Plasmid#74302PurposeExpression of Magneto2.0-p2A-mCherry in Rohon-Beard sensory neurons of the zebrafishDepositorUseZebrafishTagsFLAG, cmcl2::EGFP, and p2A-mCherryMutationTRPV4: delta 760-871PromoterNeurog1Available SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
ePB-PURO-FLAG-METTL3-APPA
Plasmid#160253PurposeFor stable integration of catalytic inactive FLAG-METTL3 in human cells with trasposaseDepositorInsertmethyltransferase like 3 (METTL3 Human)
TagsFLAGExpressionMammalianMutationchanges in aa 395–398, DPPW → APPAPromotertight TRE promoterAvailable SinceNov. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DHFR.dn-cHSF1
Plasmid#134729PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1_Puro_hPGK1_hGEM(1-110)_mNG_hSLBP(18-108)_FS
Plasmid#191527PurposeDonor for targeted integration of 3xFLAG-2xSTREP tagged S-phase specific probe (FUCCI-S) to the AAVS1 safe harbor locusDepositorInserthGEM(1-110)_mNG_hSLBP(18-108)
UseCRISPR and Synthetic BiologyTagsmNeonGreen (mNG) + 3xFLAG_TwinStrepExpressionMammalianAvailable SinceFeb. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-puro-hRAF1-shRNA-1
Plasmid#185371PurposeFor tetracycline-inducible mammalian expression of shRNA: CATGAGTATTTAGAGGAAGTA that targets human RAF1DepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-CSNK1A1 G40N-Puro
Plasmid#123320PurposeLentiviral vector for expression of Flag tagged CK1alpha G40N-P2A-Puro casette from a CMV promoterDepositorInsertCSNK1A1 (CSNK1A1 Human)
UseLentiviralTagsFlagExpressionMammalianMutationchanged Glycine 40 to AsparaginePromoterCMVAvailable SinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
RRL.sin.cPPT.SFFV/Flag-E2-crimson.IRES-puro.WPRE (CG568)
Plasmid#139445PurposeLentiviral vector to ectopically express Flag-tagged E2-crimson from SFFV promoterDepositorInsertFLAG-tag E2-crimson
UseLentiviralTagsFLAGExpressionMammalianPromoterSFFVAvailable SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hWWTR1-W1K)-PGKpuro2AmCherry-W
Plasmid#163176PurposeLentiviral gRNA plasmid targeting human WWTR1 gene, co-expression of mCherry tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBabe-TetCMV-puro-mVenus-LOV
Plasmid#22033PurposeMammalian expression of mVenus tagged LOV2 domainDepositorInsertmVenus-LOV
UseRetroviralExpressionMammalianMutationInsert length based on Venus (720bp) + LOV (450bp)Available SinceSept. 11, 2009AvailabilityAcademic Institutions and Nonprofits only -
pLVX puro TRIM21 C54Y - GFP
Plasmid#116942PurposeExpression of TRIM21 C54Y -GFP fusionDepositorAvailable SinceFeb. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro pI3K p110 CAAX
Plasmid#13339DepositorAvailable SinceOct. 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTopo pLox hPGK-Puro pA pLox
Plasmid#171048PurposeEmpty donor template for CRISPR/Cas9 targeting of TERT RE'sDepositorTypeEmpty backboneUseCre/LoxExpressionMammalianAvailable SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBABE puro Brca1 S1423A S1524A HA
Plasmid#41968DepositorAvailable SinceApril 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pBabe puro H-Ras G12V Y40C
Plasmid#12276DepositorInsertH-Ras G12V Y40C (HRAS Human)
UseRetroviralExpressionMammalianMutationContains G12V activating mutation. The Y40C mutat…Available SinceJuly 20, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLentiPGK Puro DEST JNKKTR EE Clover
Plasmid#90239PurposeLentiviral vector to express JNK KTR EE (mutant) mClover under PGK promoter (With Puromycin Resistance)DepositorInsertJNK Kinase Translocation Reporter (EE mutant)
UseLentiviralTagsmCloverExpressionMammalianPromoterPGKAvailable SinceMarch 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-Puro CAG IL13-CAR
Plasmid#157742Purposeknock IL13-CAR into AAVS1 safe harbor locus for constitutive expressionDepositorInsertChimeric antigen receptor targeting IL13
UseCRISPR, Synthetic Biology, and TALENExpressionMammalianPromoterCAGAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
Mis12-targted Aurora B FRET sensor
Plasmid#45231DepositorInsertMis12 targeted Aurora B FRET sensor
ExpressionMammalianAvailable SinceMay 31, 2013AvailabilityAcademic Institutions and Nonprofits only