We narrowed to 10,117 results for: transfer
-
Plasmid#216116PurposeEncodes the loss-of-function mutation C199S of the genetically encoded, green fluorescent peroxide sensor oROS-G in AAV viral vectors.DepositorInsertoROS-G_LF(C199S)
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
MTOR-F2108L_DARIC(1)_CD19-scFv_AAV6_Donor
Plasmid#211905PurposeVector for AAV6 donor production. Targeted CD19-scFv DARIC transgene integration to the MTOR locus with the dominant rapamycin resistance MTOR-F2108L mutation via homology-directed repair.DepositorInsertDARIC-CD19-scFv
UseAAVExpressionMammalianPromoterhPGK1Available SinceFeb. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_E210A
Plasmid#204475Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B E210A mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_R153X
Plasmid#204476Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B R153X mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_V748L
Plasmid#204477Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B V748L mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_E993A
Plasmid#204479Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B E993A mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLenti HsATP10B_I1038T
Plasmid#204480Purposetransfer plasmid for lentiviral vector production expressing Hs ATP10B I1038T mutantDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
miR5 HsATP10B
Plasmid#204481Purposetransfer plasmid for lentiviral vector production with miR for Hs ATP10BDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_8xTEAD_luc2
Plasmid#173005Purposefirefly luciferase reporter vector with 8x clustered TEAD binding sitesDepositorInsert8xTEAD-luc2
UseAAV and LuciferaseExpressionMammalianAvailable SinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TRE-IEo
Plasmid#201992PurposeAAV vector mediating inducible expression of codon optimized immediate early gene IE180 of pseudorabies virusDepositorInsertInducible expression of codon optimized immediate early gene IE180 of pseudorabies virus
UseAAVPromoterTight TREAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFPnls barcode-210-SV40 polyA
Plasmid#190876PurposeFor barcoded retrograde labelingDepositorInsertEGFPnls-barcode210
UseAAVMutationWTAvailable SinceAug. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV1-DIO-eGFP-pvRPL10a
Plasmid#202542PurposeCr-dependent (DIO) expression of eGFP-tagged ribosomal subunit that uses the prairie vole RPL10a gene sequence under the human synapsin promoter.DepositorInsertRPL10a subunit of the ribosome
UseAAV and Cre/LoxTagseGFPExpressionMammalianMutationoptimized for prairie vole DNA sequence and optim…Promoterhuman synapsinAvailable SinceAug. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-9-SV40 polyA
Plasmid#190873PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode9
UseAAVMutationWTAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform E (codon optimized)
Plasmid#199570PurposeStable and dox. inducible expression of Trim69 isoform E (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform E (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform D (codon optimized)
Plasmid#199569PurposeStable and dox. inducible expression of Trim69 isoform D (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform D (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform C (codon optimized)
Plasmid#199568PurposeStable and dox. inducible expression of Trim69 isoform C (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform C (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CaMKIIa_SERT_mCherry
Plasmid#198736PurposeSerotonin transporter with mCherry fluorescent protein driven by CaMKIIa promoter on a AAV vectorDepositorInsertSerotonin transporter and mCherry
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-7-SV40 polyA
Plasmid#190871PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode7
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-8-SV40 polyA
Plasmid#190872PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode8
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-EGFP barcode-6-SV40 polyA
Plasmid#190870PurposeFor barcoded retrograde labelingDepositorInsertEGFP-barcode6
UseAAVMutationWTAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-Gat1(R69K)-HA-WPRE-HGHpA
Plasmid#184636PurposeExpresses the GABA membrane transporter Gat1 R69K mutant fused to HA, driven by the Ef1a promoter, in a Cre-dependent fashionDepositorInsertGat1 (Slc6a1 Mouse)
UseAAVMutationGat1 gene with Arginine 69 changed to Lysine, to …PromoterEF1aAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only