We narrowed to 2,775 results for: SAB;
-
Plasmid#110320PurposeTRCN0000048179 (Target GTCCCTGCATATCGTCATGTT), silence human ARL4C gene and express monomeric Kusabira-Orange2DepositorInsertARL4C (ARL4C Human, Homo sapiens)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Kinases
Pooled Library#51044PurposeSub-pool of Sabatini/Lander sgRNA library enriched for kinase targets.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Nuclear
Pooled Library#51047PurposeSub-pool of Sabatini/Lander sgRNA library enriched for nuclear targets.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Cell Cycle
Pooled Library#51046PurposeSub-pool of Sabatini/Lander sgRNA library enriched for cell cycle-related targets.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Control
Pooled Library#51048PurposeSub-pool of Sabatini/Lander sgRNA library enriched for control targets.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Unknown Function
Pooled Library#51043PurposeSub-pool of Sabatini/Lander sgRNA library enriched for gene targets of unknown function.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
Human Lentiviral sgRNA Library - Ribosomal Proteins
Pooled Library#51045PurposeSub-pool of Sabatini/Lander sgRNA library enriched for ribosomal gene targets.DepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceFeb. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pEMS1428
Plasmid#29224PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorInsertPle168 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1091
Plasmid#29025PurposePleiades (Ple) MiniPromoter expression pattern described in Portales-Casamar et al., PNAS, 2010 (PMID: 20807748) and de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle167 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1092
Plasmid#29026PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle168 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-Cre-NLSExpressionMutationPromoterAvailable sinceJan. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1427
Plasmid#29223PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorInsertPle167 (POGZ Human)
UsePleiades promoter project [sic, pleaides plieades]TagsEGFP-NLSExpressionMutationPromoterAvailable sinceNov. 16, 2011AvailabilityAcademic Institutions and Nonprofits only -
Human CRISPR Metabolic Gene Knockout Library
Pooled Library#110066PurposeEncodes gRNAs for targeting metabolic genes in CRISPR screens.DepositorUseLentiviralAvailable sinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
mTORC1 Focused library
Pooled Library#164084PurposeLentiviral CRISPR library targets human mTORC1 signaling pathwayDepositorExpressionMammalianSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
Watermelon
Pooled Library#155257PurposeLineage tracing libraryDepositorExpressionMammalianUseLentiviralAvailable sinceOct. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
Pan-Druggable Cancer Library
Pooled Library#182133PurposeAll-in-one CRISPR/Cas system with 74 individual elements. 63 elements target cancer-related genes with FDA-approved drug treatments, and 3 elements target key medulloblastoma driver genes.DepositorSpeciesHomo sapiensUseCRISPR and LentiviralAvailable sinceAug. 26, 2022AvailabilityAcademic Institutions and Nonprofits only